1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snowcat [4.5K]
3 years ago
11

what is true in a saturated solution A. No more solute can be dissolved B. No more solvent can be dissolved C. No more solution

can be made D. The concentration cannot be decrease
Biology
2 answers:
MrMuchimi3 years ago
6 0
<span> A. No more solute can be dissolved</span>
anygoal [31]3 years ago
3 0

A.) No more solute can be dissolved

Just took the test 100%

You might be interested in
Which stores ground water
kolezko [41]
Groundwater is enclosed in aquifers. Groundwater is found within a large range of rocks, but the most effective aquifers are found in porous, open cavities, and permeable rocks. Aquifers can contain salty, briny, and fresh water. Groundwater can exit the aquifer by the pumping of a well, which is usually called discharge. The answer is aquifers.

6 0
3 years ago
Transpiration is the loss of oxygen through a plant’s leaves true or false
agasfer [191]

Answer:

in plants is responsible for the timing of seasonal activities such as flowering and growth.Transpiration is the loss of OXYGEN through a plant's leaves. False- water. When the guard cells of a leaf lose water, the stomata OPEN.

Explanation:

so the answer is True

4 0
3 years ago
When the moon apprears to be growing larger it is said to be?
tresset_1 [31]
I think its illuminating
4 0
3 years ago
Why do you think the distribution of fur traits changed over time?​
drek231 [11]

Answer now it is easier for animals to adapt

Explanation:

3 0
3 years ago
Age-related loss of taste can be due to a(n) __________ number of sensory receptors
ivolga24 [154]
Age-related loss of taste can be due to a decreased number of sensory receptors. 

Good luck :)
7 0
3 years ago
Other questions:
  • At end of telophase , what must occur
    8·2 answers
  • Individuals who are heterozygous for sickle-cell anemia have a greater resistance to
    15·1 answer
  • How can an organism benefit from asexual reproduction?
    8·1 answer
  • What is required for reactants to form bonds?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 10 points and brainliest for the first to answer!
    6·2 answers
  • Magma that hardens vertically underneath the surface will form a sill.
    13·2 answers
  • Where in the cell does most cellular respiration occur
    11·1 answer
  • Humans are able to move their shoulder 360 degrees. What morphological features aid in this degree of motion (i.e. which bones)?
    5·1 answer
  • What does DNA replication mean?​<br><br>thankyou ~
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!