1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

How does organization play a role in homeostasis

Biology
1 answer:
Mashutka [201]3 years ago
8 0
Organization is important because the structure denotes the function in biology, therefore organization in this case means that it has a high relevance for homeostasis. If something is not organized, it's not in homeostasis, it's as simple as that. 
You might be interested in
Can someone please help me on these? I would like a simple answer, as I'm waiting on someone to get back but they can't come for
scoray [572]
1. 186.6 g (C)

2. 24

3. Synthesis

4. Endothermic

5. Rate

6. Accelerate

Hope this helps! Enjoy! <span />
7 0
3 years ago
Which scenario describes a renewable resource being used for energy?
Ann [662]
Wind energy
Hydro power energy
Geothermal energy
Solar energy
6 0
3 years ago
What are the function of an enzymes of the animals body​
Mekhanik [1.2K]
In animals, an important function of enzymes is to help digest food. Digestive enzymes speed up reactions that break down large molecules of carbohydrates, proteins, and fats into smaller molecules the body can use... hope this helps
7 0
3 years ago
A mutated form of hemoglobin, known as hemoglobin Lepore occurs rarely in the human population. Hemoglobin Lepore has a deleted
Andre45 [30]

Answer:

If it is still maintained in the human population, hemoglobin Lepore must be selected for in evolution.

4 0
3 years ago
Help- I need to write a response pls- I have like 5-6 mins
docker41 [41]

Answer:

hjuhkjj

Explanation:

5 0
3 years ago
Other questions:
  • Question 2 of 10 of the day!
    9·2 answers
  • Which of the following is an example of federalism?
    10·1 answer
  • Passive transport can only occur when there is a concentration gradient of low to high for a substance?
    8·1 answer
  • What is the difference between a pressurized water reactor and a boiling water reactor?
    9·1 answer
  • In a cross between individuals of a species of tropical fish, all of the male offspring have long tail fins, and none of the fem
    11·1 answer
  • Response to sign stimuli, or releasers, is generally based upon which of the following?
    6·1 answer
  • How do non genetic traits get passed on to offspring
    14·1 answer
  • Is the answer I choose for this correct
    6·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • BRAINLIEST IF RIGHT
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!