1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ugo [173]
3 years ago
10

How does animal cells and plant cells relate?

Biology
2 answers:
MArishka [77]3 years ago
7 0

Answer: Structurally, plant and animal cells are very similar because they are both eukaryotic cells. They both contain membrane-bound organelles such as the nucleus, mitochondria, endoplasmic reticulum, Golgi apparatus, lysosomes, and peroxisomes. Plant cells can be larger than animal cells.

Explanation:

makvit [3.9K]3 years ago
7 0

Answer: In the structure both plant and animal cells are very similar both are eukaryotic cells and both have membrane bound organelles.

You might be interested in
Inadequate calcium in the neuromuscular junction would directly affect which of the following processes?
AysviL [449]

Answer:

a. Release of acetylcholine from the synaptic vesicles

Explanation:

The events on neuromuscular junction:

Action potential travels through the membrane of the presynaptic cell causing the voltage-gated channels permeable to calcium ions to open. Ca2+ flow through the presynaptic membrane and increase the Ca concentration in the cell which will activate proteins attached to vesicles that contain a neurotransmitter (e.g. acetylcholine). Vesicles fuse with the membrane of the presynaptic cell, thereby release their contents into the synaptic cleft-space between the membranes of the pre- and postsynaptic cells. Neurotransmitter ACh binds to its receptors on the postsynaptic membrane and its binding causes depolarization of the target cell (muscle cell). Depolarization occurs because sodium enters the cell as a result of neurotransmitter receptor binding.

3 0
3 years ago
Which fl industry is the cape Canaveral? fishing/ mining/ aerospace/agriculture
vodka [1.7K]

Answer:

Aerospace

Explanation:

7 0
2 years ago
why do all organisms take in matter and rearrange atoms through chemical reactions to form molecules essential for life?
Tom [10]
Cause living things can not directly use most of matter which they found in nature. For example carbon, all organism use carbon in complex structure, that is in compound or macromolecule(glucose,fructose,amino acid). we can not directly earn ATP from C which we found in soil/other sources.
3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Please help with this question I am so confused!​
Angelina_Jolie [31]

Answer:

prokaryotic cells only

Explanation:

6 0
3 years ago
Other questions:
  • Select all of the following which are examples of physical change.
    13·2 answers
  • The Structure of the Neuron Neurons: Nerve cells, the basic elements of the nervous system Have a cell body that contains a nucl
    5·1 answer
  • Describe cellular respiration. How do plants and animals help each other in cellular respiration?
    8·2 answers
  • The photograph Depicts a condition called syndactyly. Explain what might have happened during development to result in this cond
    10·1 answer
  • What surface cost the least fraction? a. Rock b. Grass c. Dirt d. Ice
    8·2 answers
  • When you by strawberry is "TEXTURE " matters? and why is that?
    13·2 answers
  • 1. Which of the following best explains how
    8·1 answer
  • How do wales differ from fish
    8·2 answers
  • Marisol is trying to get to work on time. She's walking to the bus
    15·1 answer
  • What are CD4 cells?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!