Answer:
C
Explanation:
Bulls are a more extreme version of a cow. A cow is like a mother who cares for her children while a bull is like a rowdy person who does weird and unpredictable things at times. That's why when people hear the word wild cow, they don't usually get frightened but when they hear the word wild bull, they kind of get afraid.
Answer:
The right answers are mentioned in the picture.
A base pair (bp) is the pairing of two nucleobases located on two complementary strands of DNA or RNA. This pairing is carried out by hydrogen bridges. There are four types of nucleic bases: A-T-C-G, these letters Adenine, Thymine, Cytosine, and Guanine. A with T and C with G.
It is also necessary to take into account the antiparallel character of the DNA strands. If a strand is in the 5 '3' direction, its complete strand is in the 3 '5' direction.
Explanation:
Answer: Yes, Endocytosis and exocytosis can occur in the same cell. It is how a cell transport and export material in and out.
Explanation: Hope this helps :) and amazing question btw
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
On the basis of gender preference.
Explanation:
In the modern view of adaptation, the main cause of infanticide is not the food but the gender preference. In many societies, people killed their infant when they knew that the infant is a girl. They thought that having a girl is curse or shameful thing so they kill the infant. These type of people wants male baby or prefer male child so that's why they kill the infants. In the ancient times, infants were killed that were abnormal or having any defects but today it happen due to gender preference.