Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
<span>The amino acid sequence contains the necessary information </span>to<span> determine how that particular </span>protein will<span> fold into a 3-dimensional structure as well as the stability of the resulting structure.</span>
Fire resistance is where the amount of time that material has withstood a standard fire exposure whereas flame spread is the speed at which a flame spread along the surface of a specific material and is considered as the difference between fire resistance and flame spread.
Fire resistance is the resistance to fire that is for a particular specified time and is under circumstances of standard heat intensity. It will not structurally fail or else allow the transition of heat and also not permit the side away from the fire so as to become hotter than a temperature that is specified well.
Flame spread is described as the surface burning characteristics enhanced by building materials. It is the most tested property of the fire performance of a material.
Firefighters should be aware of the growth and spread of a fire as they face respiratory hazards in emergency situations which include oxygen deficiency, temperature elevation, smoke as well as toxic atmospheres. This can also affect both the physical and mental effects of the firefighter and would be worse if proper respirator precautions are not followed.
This indicates that firefighters are regularly exposed to certain concentrations of hazardous materials that include carcinogenic products such as carbon monoxide, benzene, sulphur dioxide, hydrogen cyanide, aldehydes as well as particulates.
Learn to know more about fire resistance at
brainly.com/question/11471513
#SPJ4
It contracts and is pulled downwards
