1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
4 years ago
13

What does the atomic number of an element represent

Biology
2 answers:
kati45 [8]4 years ago
5 0
Stands for the distinct identity of a chemical elemnent
Soloha48 [4]4 years ago
4 0
<span>The atomic number is the number of protons present in an atom of that distinct element which is also the number of electrons carried in that atom. 

</span>
You might be interested in
Allergens differ from antigens because ________. Allergens differ from antigens because ________. allergens do not involve the l
Vera_Pavlovna [14]

Answer:

Allergens differ from antigens because *they do no stimulate the immune system resulting in the production of leukocytes rather than the stmulate the IgE antibodies*

Explanation:

Allergen and antigen are both foreign substances that can cause certain disorders to animals, but there is some difference between them in terms of their nature and the diseases caused by them. An allergen is a nonparasitic foreign substance that can cause certain immune reactions in the body when it enters the body.  Whereas, an antigen is a foreign substance that can trigger the immune system to produce a specific immune response. This immune response leads to produce antibodies that can neutralize or destroy the foreign substances that entered the body.

Allergens can produce Systemic Allergic Response. Allergens stimulate the IgE antibodies by binding to them on the mast cells and causing the mast cells to rupture and release histamine, serotonin, and heparin, initiating inflammatory response.

4 0
4 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
An example of a properly functioning homeostatic control system is seen when
ANEK [815]

Answer:

the kidneys excrete salt into the urine when dietary salt levels rise

Explanation:

Hyponatremia is an electrolyte imbalance, with a low level of sodium in the blood. The normal value of sodium in adults is 136 to 145 mEq / L. Sodium is an element, or electrolyte of the blood. Sodium chloride is commonly known as table salt.

Certain conditions can cause decreased sodium in the blood. Specific causes of hyponatremia include:

Water poisoning (water replacement without electrolyte replacement).

Problems in the kidneys, heart or liver.

Medications: such as diuretics, Heparin, certain chemotherapeutics (Aminoglutethimide, Cyclophosphamide and Vincristine).

Conditions related to steroids, hormones or metabolic defects, such as a syndrome that alters the secretion of antidiuretic hormone (SSIHA). If this occurs, you urinate frequently and the kidneys excrete too much sodium. This can result from many conditions, including certain types of lung cancer.

6 0
3 years ago
Urine is transported from kidney to the urinary bladder by the.
erastova [34]

Answer:

ureters

Explanation:

The ureters are two tubes that drain urine from the kidneys to the bladder. Each ureter is a muscular tube that drains into the bladder. Smooth muscle contractions in the walls of the ureters, over time, send the urine in small spurts into the bladder, the organ where urine is stored before it can be eliminated.

7 0
3 years ago
A small chemical spill in the lab is cleaned up by using paper towels . Where should the dirty paper towels be placed ?
DENIUS [597]
They should be disposed of.
8 0
3 years ago
Other questions:
  • How can one species eventually change into something completely different over the course of millions of years?
    7·1 answer
  • The area of shoreline that is alternately exposed and submerged is the _____.
    9·2 answers
  • Why do animals such as a hedgehog<br> hibernate during the cold winter<br> months?
    11·1 answer
  • What reaction takes place in the stroma
    5·1 answer
  • Which layer do you usually see in photographs of the sun
    10·2 answers
  • About what percent of children between 6 and 11 years of age in the United States are considered overweight
    9·2 answers
  • Guys, please. I genuinely need help! If you don't know- don't answer. And please don't look it up on g00gle, those type of answe
    15·1 answer
  • Heelppp meeeeeeeee pleeeaaseee
    8·2 answers
  • Quick need an answer!!<br><br><br> Cholesterol is a bad lipid. do you agree or disagree, and why?
    12·2 answers
  • How people often take vitamins needlessly or in excess, resulting in excretion in urine of water-soluble vitamins and potentiall
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!