1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enot [183]
3 years ago
8

How can you see change over time using topographic maps and satellite images?

Biology
1 answer:
Alexus [3.1K]3 years ago
3 0

Topographic maps and satellite images

Explanation:

A topographic map represents earth's surface features like land forms and structures, rivers and lakes, mountains and hills, elevations and other natural features along with man-made artificial features like cities, buildings, monuments, roads, bridges etc. These are formed by contour lines.

Topographic maps are printed with revision dates to observe the changes happening on the Earth's surface. Various land forms keeps changing due to natural and man-made causes and these needs to be updated accordingly to provide accurate details.

A satellite image provides details of the earth aerially from space. These provides details of a land form or any earth structure currently.

By comparing with older satellite images or topographic maps with the current one, the changes which occurred over time can be observed.

You might be interested in
What are two effects of too much exposure to radiation
liq [111]
Heat and flame jetting

7 0
3 years ago
Read 2 more answers
The mantle is always solid. True or false?
zubka84 [21]

Answer:

It is predominantly solid but in geological time it behaved as a viscous fluid.

Explanation:

7 0
2 years ago
Read 2 more answers
If the low power objective lens has 10x printed on the lens, what would be the total magnification?
Anestetic [448]

I believe it is c 100x because you multiply the 10 by the power of the eye piece which is usually 10 and 10 multiplied by 10 is 100

3 0
3 years ago
Why is there a pit, a hole, in me... that want's someone's love, and not just anyone's, but some specific person that I don't ev
iVinArrow [24]
Well everyone's needs for love and attention are different. It can depend on how you were raised, if you received a lot of attention as a kid, etc. Humans are social creatures so we already crave human interaction. and, going back to how you were raised, even if you were raised quite well and you got enough attention as a kid, it really depends on how people treated you and maybe how many times you've had your heart broken or something along those lines. That need honestly varies from person to person. But I know how it feels, you'll get through it, you'll be okay.
3 0
3 years ago
Read 2 more answers
Help me please,Thanks
BigorU [14]
Okay. About 71% of the Earth's surface is water. And salt water holds about 96.5% of all the Earth's water. The remaining 3% of freshwater is found in Glaciers and ice caps making it difficult to use because it is frozen. Other places freshwater can be found is: Lakes, swamps, rivers and the atmosphere. I hope this helps!
8 0
3 years ago
Other questions:
  • How does independent assortment create genetic variation?
    14·1 answer
  • What are the two types of hormones and how do they differ in the way they work?
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The American Board of Forensic Entomologists certifies scientists who study_____.
    10·2 answers
  • What are five things that change quickly that you can see
    13·1 answer
  • Innate immunity and acquired immunity are both _____. see concept 43.1
    10·1 answer
  • Which statement is true about the effect of red tide or algal bloom on the ecosystem?
    5·1 answer
  • What is the overall purpose of photosynthesis
    13·1 answer
  • Which of the following DOES NOT regularly use the atmosphere during its process?
    8·1 answer
  • What is the average height of 5 trees if the measurments are: 2.39, 2.39, 1.04, 2.44 and 0.28
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!