1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikentia [17]
3 years ago
11

Vitamin e is carried to the liver and other tissues by

Biology
2 answers:
lubasha [3.4K]3 years ago
7 0
Vitamin E is an example of a a fat soluble vitamin together with vitamins A, D and K. It is carried to the liver and other tissues by lipoproteins. Vitamin E functions to protect phospholipids in cell  membranes from damage by free radicals. It is also important to note that a high intake of vitamin E can interfere with vitamin K's blood clotting activity. 
Alex17521 [72]3 years ago
6 0

Vitamin E is carried to the liver and other tissues by lipoproteins

Vitamin E is hydrophobic. It can be absorbed just like every other dietary lipid. Vitamin E is absorbed into intestinal epithelial cells after the solubilization of bile acid, it is incorporated into chylomicrons (they are lipoproteins particles that are made of up phospholipids, cholesterol, triglycerides and proteins), and move into the blood through the lymph system.

<h2>Further Explanation</h2>

Vitamin E is separated from chlomicrons during circulation and much is reabsorbed by the liver and repackaged into a low density lipoprotein which is then released into the blood.  

Vitamin E is then transported in blood bound to different classes of lipoproteins and it is absorbed by the tissue and spread throughout the body.

The sources of Vitamin E are so many. It can be found in vegetable oil, including wheat germ, sunflower, safflower oil and foods such as margarine. It is found in green vegetables (broccoli, spinach).  

Vitamin E can also be found in nut and seed (hazelnut, sun flower seeds), sea food (abalone, salmon),  

Vitamin E performs different functions in the body, and these include:

  • Vitamin helps to boost the body immunity
  • It helps to support the function of the cells
  • It is used widen blood vessels and reduce the risk of blood clot.

KEYWORDS:

  • lipoproteins
  • vitamin E
  • liver
  • transport
  • tissues
You might be interested in
Food Web <br><br>please help ​
a_sh-v [17]
A. land plants, tiny water plants
a. slug, frog, newt
b. plants, slug-insect-water fleas, frog-fish-newt, perch-fox, heron
c. water fleas, diving beetles
d. heron, perch
e. one thing that could happen if all frogs suddenly died is that there would be an overpopulation of slugs, insects, and beetles. another thing that could happen would be that foxes would only rely on getting slugs for food so the slugs would soon go extinct and the plants would possibly over populate.

hope this helps!!
7 0
2 years ago
Read 2 more answers
Schools are looking for a balanced food option to serve their students.
denis-greek [22]

Schools have to give proper meals and carbohydrates to students.

<h3>What is a balanced diet?</h3>

A balanced diet is one that includes a variety of foods in the right amounts and ratios to meet the body's needs for calories, proteins, minerals, vitamins, and other nutrients. A small portion of the diet is also set aside for extra nutrients to last through the brief period of leanness. In this situation, we must choose a unique menu that offers the

In this context, we have to first prepare the list of the number of carbohydrates, lipids, and proteins and then we have to identify the maximum amount required in the meal. then observe the common food in the school.

Learn more about a balanced diet here:

brainly.com/question/10669660

#SPJ1

6 0
1 year ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Cells from advanced malignant tumors often have very abnormal chromosomes as well as an abnormal number of chromosomes. What mig
patriot [66]

Answer:

<u>Option- D: </u>Is the best choice to choose from the given options.

Now, let us explain the term Cell cycle in a more comprehensive way.

<u>As the cell cycle is controlled at three checkpoints.</u>

  • The integrity of the DNA is assessed at the G₁ checkpoint.
  • Proper chromosome duplication is assessed at the G₂ checkpoint.
  • Attachment of each kinetochore to a spindle fiber is assessed at the M checkpoint.

Explanation:

The cell cycle is controlled by three internal checkpoints that evaluate the condition of the genetic information.

  1. <u>The G₁ Checkpoint</u>:This stage determines whether all conditions are favorable for cell division to proceed. The cell can halt the cycle and attempt to remedy the problematic condition, or the cell can advance into G₀ (inactive) phase and await further signals when conditions improve.
  2. <u>The G₂ Checkpoint:</u> The most important role of the G₂ checkpoint is to ensure that all of the chromosomes have been accurately replicated without mistakes or damage.
  3. <u>The M Checkpoint:</u>It occurs near the end of the meta-phase stage of mitosis. it determines whether all the sister chromatids are correctly attached to the spindle micro-tubules
5 0
3 years ago
Researchers have been developing an artificial leaf, a device that mimics the actions of photosynthesis. The artificial leaf har
Vikentia [17]
The answer is C. The products contains high energy chem bonds
3 0
2 years ago
Read 2 more answers
Other questions:
  • Compared with deciduous forests, coniferous forests _____. tend to contain more broadleaf evergreen trees are more likely to be
    14·2 answers
  • Which of the following is true regarding audience?
    15·2 answers
  • The earths interior heat and pressure drivedl a proccess of heat transfers in the mantle called
    12·1 answer
  • Which disease is the result of destruction of alveolar walls?
    10·2 answers
  • The color of light that is LEAST useful to a plant during photosynthesis is
    9·1 answer
  • Which kind of graph would be best for depicting data collected on the weight of a baby every month for six months?
    11·1 answer
  • Which of the following processes makes us sweat when we exercise?
    8·2 answers
  • Which best describes the limits of science?
    11·2 answers
  • Which type of reproduction involves only one parent?
    9·2 answers
  • Brbtbrbtbt rbt tbtbrntbtbt rbtbrbt
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!