Answer is 55%.
Blood is fluid connective tissue that consists of two main components, plasma and formed element. Blood plasma is a clear extracellular fluid, which is a mixture of proteins, enzymes, nutrients, wastes, hormones and gases. Formed elements are made up of the blood cells (red blood cells and white blood cells) and platelets. All formed elements are cells except for the platelets, which are tiny fragments of bone marrow cells.
The formed elements can be separated from plasma by centrifuge. On separation of blood components, it is evident that formed elements make up 45% of total blood volume while the plasma makes up 55% of the total volume.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer: A pea inside the pod is formed from an ovule.
Explanation:The ovule is part of structure the female reproductive organ in seed plants. It’s the place where female reproductive cells are made and contained, and it is what eventually develops into a seed after fertilization, only for the seed to then ripen and produce a complete adult plant. Ovules are contained in ovaries at the bottom of a vase-like structure, the carpel, which has a neck called a style and an opening at the top, called a stigma.
Answer:
D. G2 phase
Explanation:
The G2 phase is last phase or stage that occurs in the metabolic phase of a cell cycle also know as the Interphase.
The G2 phase is referred to as the cell division phase in a cell cycle. It is a phase whereby twice as much DNA as the normal diploid state is found in the cell but is no longer in the process of replicating the DNA and all of the DNA is found within a single nucleus.
