1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bingel [31]
3 years ago
10

How many neuromuscular junctions are in each muscle cell

Biology
1 answer:
yuradex [85]3 years ago
5 0

Answer: One

Explanation:

A neuromuscular junction is a chemical synapse between the muscle fibre and the motor neuron. It helps the motor neuron to send a signal to the muscle fibre, triggering contraction in the muscle.

One Muscle Fiber has one neuromuscular junction in most skeletal muscles. A mature neuromuscular junction is innervated by one motor nerve terminal ; thus, the relationship between a given muscle fibre and motor neuron is one-to-one.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
How much more energy is produced by aerobic respiration than by anaerobic respiration?
mojhsa [17]
Aerobic respiration produces 38 ATP, while anaerobic respiration only produces 2 ATP. I hope that answered your question, my friend. :)
5 0
3 years ago
The most electronegative atoms typically present in biological molecules are ____ and ____.
Lapatulllka [165]
<span>The most electronegative atoms typically present in biological molecules are O and N.
Hope this helps

</span>
3 0
3 years ago
PLEASE HELP! - Describe why carbon, hydrogen, oxygen, nitrogen, &amp; other elements can combine. Describe the results of these
lbvjy [14]

Answer:

Carbon, Oxygen, Hydrogen And Nitrogen - Have In Common? They All Have The Same Number Of Valence Electrons. They All Have Unpaired Electrons In Their Valence Shells. They Are Elements Produced Only In Living Cells.

7 0
3 years ago
For most stars, what does a higher temperature tend to go with?
Korvikt [17]
I think the answer is a red color
7 0
2 years ago
Read 2 more answers
Other questions:
  • Why would PCD make it difficult to get pregnant or have a baby
    13·1 answer
  • Witch sentence most likely explains why the rock has large open pores
    15·1 answer
  • Which of Mendelssohn laws states that only one parental allele for each trait is included in a sex cell
    13·1 answer
  • Which of the following is an example of a chemical change
    14·2 answers
  • Help now! Please! I’ll mark you Brainly
    9·1 answer
  • How do runoff and groundwater differ
    12·1 answer
  • When plants are transplanted into a new habitat that is not their native one.
    14·1 answer
  • Which of the following statements is true?
    12·2 answers
  • Lysosomes are membranous sacs with hydrolytic enzymes that catalyze
    14·1 answer
  • Can someone plz help me? :)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!