Most gladiators were usually slaves. Slavers sell slaves for money and the slaves are forced into an arena to fight to their deaths.Typically, a slave gladiator goes against a super strong and powerful guy that was not a slave. The spectators would typically want the super strong and powerful guy to win.
Tides would most likely be all over the place and unstable, and their wouldn't really be a full moon.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
<em><u>Answer:</u></em>
144 degrees
27 degrees
<em><u>Explanation:</u></em>
f) So angle EBD is angle 5, which is 36 degrees. Angle DBC is angle 1 and is 108 degrees. We need to find angle EBC or 5 + 1.
So we know that EBC is angle 5 + 1, we can do angle 5 plus angle 1 or:
36 degrees + 108 degrees = 144 degrees.
Angle EBC is 144 degrees.
g) So we know angle EBF or angle 4 + 3 is 117 degrees. We need to find angle ABE or angle 4. We know that angle 3 is 90 degrees because of BF is perpendicular to AC. So now we can find angle ABE or 4:
117 degrees minus 90 degrees = 27 degrees
Angle ABE is 27 degrees.
Answer:
Consequences number, on the one hand, deforestation and desertification, extinction of animal and plant species and changes in the water cycle and the most direct consequence of all in the form of emissions of large quantities of greenhouse gases leading to global warming.
Explanation:
