Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
The third one the second one and the first one
<span>B. The region stretching from alaska to newfoundland
</span>
Currents involve movement of ocean water masses, driven either by wind or by differences in temperature, salinity and density. The most important from a human perspective are the wind-driven surface currents that move water in the uppermost layer of the ocean.
Currents affect humans in several primary ways. Currents help shape the climate in the areas where we live, create the right conditions to support abundant ocean life in the areas where we fish, and change weather patterns through periodic events like El Nino/La Nina.
Ocean currents also cause upwelling in many areas like off in the inland parts of North America, where surface currents taking water away from the shore cause nutrient-rich water to well up from the ocean deeps. The abundance of nutrients in these areas forms fertile ground for kelp beds and marine fisheries, which in turn furnish food for humans. Alterations in current patterns like the El Nino/La Nina cycle affect humans as well by causing changes in local weather patterns in the years when they occur.
<h2>How You Can Stop Global Warming</h2>
<h3>1,Speak up! ... </h3>
<h3>2)Power your home with renewable energy. ... </h3>
Weatherize, weatherize, weatherize. ...
Invest in energy-efficient appliances. ...
Reduce water waste. ...
Actually eat the food you buy—and make less of it meat. ...
Buy better bulbs. ...
Pull the plug(s).
