1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveta [45]
3 years ago
7

Which chamber of the heart pumps oxygen-poor blood to the lungs?

Biology
1 answer:
viktelen [127]3 years ago
6 0
The chamber is the R<span>ight Atrium which is the upper right chamber of the heart

Hope this helps </span>
You might be interested in
The proccess of photosynthesis can be represented by the chemical formula _________
masya89 [10]

Answer:

6H2O + 6CO2 ----- C6H1206 + 6O2

7 0
3 years ago
. During development, some cells become liver cells, somet
Alex

Answer:

Cellular differentiation.

Explanation:

Cellular differentiation is the process in which a cell changes from one call type to another. Usually, the cell changes to a more specialized type. Differentiation of a multicellular organism as it changes from a simple zygote to a complex system of tissues and cell types.

4 0
3 years ago
Newton's Law Song Verse
Crazy boy [7]

Explanation:

is this an actual question!?? lol!

5 0
3 years ago
Read 2 more answers
May someone help me please
Travka [436]
The answer is molecules
6 0
3 years ago
Read 2 more answers
What type of boundary causes volcanoes
zvonat [6]

Hot spots, Divergent plate boundaries and Convergent plate boundaries

5 0
3 years ago
Other questions:
  • Which diet instructions are appropriate when teaching a client in the early stages of cirrhosis about nutritional needs? select
    7·1 answer
  • What are the processes of a rock becoming a rock
    12·1 answer
  • What is the pigment in chloroplasts that performs photosynthesis
    6·1 answer
  • Which of Darwin's postulates are vital in order for evolution to take place?
    11·1 answer
  • Hot springs in Yellowstone National Park can reach 205 degrees Fahrenheit (96 degrees Celsius), a temperature at which few organ
    9·1 answer
  • When were dinosours discovered​
    5·1 answer
  • Would it be more deleterious (harmful) for the first Adenine in the DNA sequence to be replaced with a Cytosine or for the first
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Using scientific language explain first why the earth goes through seasons (winter, spring, summer, fall) and then explain speci
    8·2 answers
  • The principle hormones produced by the thyroid gland are:.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!