1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
7

Please Help In You're Own Words No Guessing(40 Points) (Science) In your own words, explain what the atomic number and atomic ma

ss of an element represent. Use an example of an element if it helps you with your description.
Describe how the atomic number and atomic mass of an element are calculated.
Biology
1 answer:
IrinaVladis [17]3 years ago
5 0
Mass number is the number of protons and neutrons in an atom, and it tells us about the mass of the atom<span> in amu, or </span>atomic mass units. Atomic mass<span> is the average</span>mass of all the isotopes of a certain type. It is a weighted average that takes into account the abundances of all of the different isotopes.The full chemical symbol for an element shows its mass number at the top, and its atomic number at the bottom. This symbol tells you that the chlorine atom<span> has 17 protons. It will also have 17 electrons, because the </span>number of protons and electrons in an atom is the same.The atomic number specifies how many protons an element has in its nucleus. In the periodic table<span> of the elements, elements are arranged in order of ascending atomic number. Isotopes are atoms that have the same number of protons but different numbers of neutrons.</span>
You might be interested in
In a cladogram, what occurs at a node?
avanturin [10]
<span>A terminal node is the hypothetical last common ancestral interbreeding population of the taxon labeled at a tip of the cladogram. An internal node is the hypothetical last common ancestral population that speciated (i.e., split) to give rise to two or more daughter taxa, which are thus sister taxon to each other</span>
3 0
3 years ago
Cual es el orden correcto de mitosis
Ganezh [65]

Answer:

Profase - Metafase - Anafase - Telofase - Citocinesis

Explanation:

Estas fases ocurren en orden estrictamente secuencial y la citocinesis —el proceso de dividir el contenido de la célula para hacer dos nuevas células— comienza en la anafase o telofase. Etapas de la mitosis: profase, metafase, anafase y telofase. La citocinesis típicamente se superpone con la anafase o telofase.

4 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Extreme range temperatures can shatter rocks in deserts environment. Help me out please
Musya8 [376]
I believe it’s | Weathering |


How you know:

The damage was done by temperature, which has to do with weather.

Erosion is usually caused overtime by water elements , and it causes the rocks to erode.

Answer: weathering
8 0
3 years ago
The gametophytes of an unknown plant are contained within the sporophyte, and the plant produces separate male and female gameto
ankoles [38]

Answer:

best conclusion lyfe cycle of dis plant is de plant is a gymnosperm nd de sporophtes is dominant phase

8 0
3 years ago
Other questions:
  • What effect does melting sea ice have on the atmosphere?
    6·2 answers
  • I need help on all 3 first person get top brainiest if all 3 are answer need it ASAP!!!
    5·1 answer
  • What method would be best for scientists to use to determine the absolute age of a Precambrian igneous rock
    10·1 answer
  • What characterizes a cold glacier?
    7·2 answers
  • A secondary immune response occurs when an antigen is encountered on a second occasion, due to exposure to a pathogen that previ
    6·1 answer
  • A ___________ is the smallest unit of life?
    9·2 answers
  • You are doing research on a bacterial species, trying to determine the nature and structure of a number of intracellular inclusi
    11·1 answer
  • Cationic detergents are surface active agents, also known as ______, which damage bacteria by binding bacterial surface proteins
    13·1 answer
  • 10 differences between plants and animals​
    7·1 answer
  • What is the difference between a rock and a mineral?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!