<span>A terminal node is the hypothetical last common ancestral interbreeding population of the taxon labeled at a tip of the cladogram. An internal node is the hypothetical last common ancestral population that speciated (i.e., split) to give rise to two or more daughter taxa, which are thus sister taxon to each other</span>
Answer:
Profase - Metafase - Anafase - Telofase - Citocinesis
Explanation:
Estas fases ocurren en orden estrictamente secuencial y la citocinesis —el proceso de dividir el contenido de la célula para hacer dos nuevas células— comienza en la anafase o telofase. Etapas de la mitosis: profase, metafase, anafase y telofase. La citocinesis típicamente se superpone con la anafase o telofase.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
I believe it’s | Weathering |
How you know:
The damage was done by temperature, which has to do with weather.
Erosion is usually caused overtime by water elements , and it causes the rocks to erode.
Answer: weathering
Answer:
best conclusion lyfe cycle of dis plant is de plant is a gymnosperm nd de sporophtes is dominant phase