Answer:
Cornell University
Explanation:
I did not know what article you refer to but I know that there is an article with this question.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
Gas B
Explanation:
12 C is the least amount of molecular kinetic energy shown.
Answer:
atom, its the only thing that does not match with the others with are cell involved
Explanation:
Answer:
mark me brainliest pls
A chromatid is one of two identical halves of a replicated chromosome. During cell division, the chromosomes first replicate so that each daughter cell receives a complete set of chromosomes.
Explanation:
