1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
12

What did Schleidan contribute to the cell theory?

Biology
1 answer:
ale4655 [162]3 years ago
7 0
He found a nuclear structure (cells) in plants by looking through a microscope

You might be interested in
Population growth with limiting factors is considered ______ growth .
tia_tia [17]

Answer:

logistic growth

8 0
3 years ago
Read 2 more answers
Regions of biomes that are an inconsistent mixture of fresh and salt water include ______. Select one: a. ponds b. lakes c. stre
Lyrx [107]
D. Estuaries

Estuaries are a place where fresh and salt water mix.
5 0
3 years ago
Which statement describes the motion of the water molecules in this situation? The water molecules move by active transport into
Neporo4naja [7]

The water molecules move by osmosis into the cell from high water concentration to low water concentration.

5 0
4 years ago
Read 2 more answers
Which level of classification contains orders but is smaller than phylum?
jeyben [28]

Answer:

it is c not b

Explanation:

6 0
3 years ago
Read 2 more answers
Snakes sheds their outer most layer of skin regularly which characteristic of life is this action and example of
Olegator [25]

Answer:

Letting go of regrets and past decision.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these geographic factors make Panama's location significant?
    6·2 answers
  • 305°
    11·1 answer
  • Which macromolecules were present in each of the samples?
    11·1 answer
  • Which human activity negatively affects the stability of the enviroment
    6·1 answer
  • Which statement is true about the cell pictured...!!!
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which statement below is true? 0.065 < 0.160 0.099 > 0.102 0.125 > 0.199 0.131 < 0.125
    15·1 answer
  • Bones is the most solid from of​
    11·1 answer
  • (AKS 4c, DOK 3) Which explanation below accurately describes the
    14·1 answer
  • Permeability coefficients measure the speed of passage of various molecules across lipid bilayers. Small nonpolar molecules and
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!