1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sav [38]
3 years ago
11

What is the measure of x, if angle 6 equals 4x and angle 7 equals 2x + 34? 112° 68° 64° 17°

Mathematics
2 answers:
lubasha [3.4K]3 years ago
8 0

Answer:

17

Step-by-step explanation:

4*17=68  

2*17+34=68

bonufazy [111]3 years ago
3 0
The answer is 64 degrees

You might be interested in
4 x (6-2)^2÷(3-1)^3<br><br>PLEASE HELP ME
natka813 [3]
I believe your answer is 8 :)
8 0
2 years ago
Read 2 more answers
In the diagram below BD is parallel to XY what is the value of y ?
Murljashka [212]
Value if y should be a = 97

83+97=180
7 0
2 years ago
Read 2 more answers
In the linear equation y=3x-4, -4 represents the slope
damaskus [11]
3 (3/1) represents the slope and -4 is the y-intercept
4 0
3 years ago
Write as a mixed number 98/5
Reptile [31]

Answer:

The answer is 19.6 or 1 9/6 hope this helps!

Step-by-step explanation:

4 0
3 years ago
Read 2 more answers
Why should people conserve energy? (Please don’t get the answer form the internet)
Taya2010 [7]
People should conserve energy because it produces a higher quality of life. Reduced emissions result in cleaner air quality. It also helps create a healthier planet and helps sustain resources we have.
7 0
2 years ago
Other questions:
  • Caitlin is at the grocery store, and she’s trying to finthe unit price on a 6-pack of drinks on sale for $2.99.
    10·1 answer
  • 2. If y varies inversely as x and y=0.8 when x = 1.8, find y when x = 4.8.
    13·1 answer
  • (0,1)(4,2) find the slope and y-intercept using the point slope formula
    14·1 answer
  • Numbers that are equal to 9.32 when increased by 4.65
    6·1 answer
  • Plz help will mark BRAINLIEST algebra 2
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Your friend claims it is possible for a rational function to have two vertical asymptotes. Is your friend correct? Justify your
    12·1 answer
  • Monique bought a shirt for $22.80 during a 30% off sale. How much does the shirt cost when it is not on sale?
    6·2 answers
  • Which of the following triangles is not an obtuse triangle?
    12·1 answer
  • Juan wants to eat fewer than 800
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!