1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivolga24 [154]
3 years ago
5

Is there DNA in your food? How do you know?

Biology
2 answers:
katrin [286]3 years ago
6 0
Yes. There is DNA in your food because all living things like us humans have DNA and food such as strawberries that have DNA. They are also living things like us.
kramer3 years ago
4 0
Yes you can find DNA in your food.
You might be interested in
The form in which the chemical energy is stored in cells during photosynthesis is?
zubka84 [21]

Answer:

Reactants

Explanation:

Hope this helps

8 0
3 years ago
Which of these is a function of the cell membrane in all cells?
Ivenika [448]

Answer:

c

Explanation:

7 0
3 years ago
Why are these two considered organic <br> molecules
Dmitriy789 [7]

Organic molecules can range in size from simple molecules to complex structures containing thousands of atoms! Although carbon is present in all organic compounds, other elements such as hydrogen , oxygen , nitrogen , sulfur and phosphorus are also common in these molecules.

5 0
3 years ago
What is the main function of the nucleus and why
AlladinOne [14]

Answer:

it stores the cell's hereditary material, or DNA, and it coordinates the cell's activities, which include growth, intermediary metabolism, protein synthesis, and reproduction (cell division). Only the cells of advanced organisms, known as eukaryotes, have a nucleus.

Explanation:

nly the cells of advanced organisms, known as eukaryotes, have a nucleus.

4 0
3 years ago
To keep a species from getting genetic diseases and inbreeding over time, new
Elan Coil [88]

Answer:

Genetic drifts and meiosis

Explanation:

4 0
3 years ago
Other questions:
  • What happens when organisms populate a new area and are isolated geographically from other populations of the same species?
    6·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A molecule of one atom of carbon and two atoms of oxygen would be written _____.
    12·2 answers
  • How are the energy needs of plant cells similar to those of animal cells? How are they different?
    7·1 answer
  • Karissa is conducting an experiment on the amount of salt that dissolves in water at different temperatures. She repeats her tes
    15·1 answer
  • Organic compounds are important to all living things<br>true or false
    12·1 answer
  • Part F
    11·1 answer
  • Place the Elodea cell in the ISOTONIC beaker. What happened to the cell? Question 4 options: It swelled It shrunk Nothing, it st
    12·1 answer
  • Match the words.
    14·2 answers
  • Computerized physician/provider order entry, or cpoe, is a process that helps prevent _____.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!