1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natita [175]
3 years ago
15

A protein may consist of as many as _____ amino acid molecules.

Biology
1 answer:
chubhunter [2.5K]3 years ago
8 0
Is this by any chance a multiple choice question? I am asking because I think that connectin is the largest protein and that contains around 33,000 amino acid molecules. My guess would be that a protein could potentially contain even more than that. I know this doesn't answer your question completely, but I hope it helps somewhat.
You might be interested in
The _____ of a food describes the extent to which the body is able to absorb the nutrients from the food and use them. bioavaila
rjkz [21]
The correct answer is bioavailability.
<span>Bioavailability is an important factor in establishing nutrient requirements and it represents the degree to which food nutrients are available for absorption and utilization in the body. The amount of a nutrient in a food that the body can actually use may vary depending on age and physiologic condition.</span>
4 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What are some of the limitations in microscope technology?
ANTONII [103]
Microscope technology gives us access to some pretty important/powerful information, however some limitations to it include: resolution limit, low magnification, & poor surface view,
7 0
3 years ago
Read 2 more answers
Which event signals the birth of a star?
juin [17]

Answer:

nuclear fusion

Explanation:

When the density and temperature at the core of the gravitationally collapsing nebula reaches values when nuclear fusion is triggered and sustained, that marks the birth of the star.

7 0
3 years ago
Read 2 more answers
Scientist who specialize in the study of fossils are called
Olegator [25]
They are called paleontologists.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Benthos are organisms that live
    10·1 answer
  • A student is scratching a mineral on a white plate in science class. What property is this student testing?
    9·2 answers
  • Study this image which statement best describes the rock shown check all that apply
    13·2 answers
  • Below are the seven properties of water that make life possible on Earth. Describe five of these properties and provide an examp
    9·1 answer
  • Of the four most abundant gases in our atmosphere, which one shows the greatest variation at the earth's surface
    5·1 answer
  • How is DNA used as evidence for evolution?
    14·1 answer
  • A fly has two alleles for the color of its eyes. The green allele is recessive, and
    14·2 answers
  • Which substances in junked cars and appliances are widely recycled?
    7·2 answers
  • The enzymes responsible for adding nucleotides to the exposed DNA bases during replication are
    11·1 answer
  • WHat are the answers 1-10 on brainpop lymphatic system pls help
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!