1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
4 years ago
5

HELPPP

Biology
2 answers:
lana [24]4 years ago
5 0

Answer:

B.Insert genes that produce anti-insect chemicals into the plant.

Explanation:

that's the answer hope this helps

Karo-lina-s [1.5K]4 years ago
4 0

How could you use biotechnology to protect a plant from insect damage? Insert genes that produce anti-insect chemicals into the plant. So B.

You might be interested in
Which plant propagation method would a peach farmer use to increase the number of peach trees?
vodomira [7]
Your answer would be Grafting.

Hope that helps [:
4 0
3 years ago
Read 2 more answers
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
The diamond-shaped region between the lower appendages is called the
Pani-rosa [81]
<span>The correct answer is "the perineum" This is the correct answer because it boarders the pubic symphysis anteriorly, the coccyx posteriorly, and both ischial tuberosities laterally.</span>
5 0
3 years ago
All the body parts receive oxygen-rich blood through
Nana76 [90]
C. red blood cells contain hemoglobin which allows the cells to transport oxygen
6 0
4 years ago
The picture is Groove in a cliff
Katyanochek1 [597]
I think it might be 4
6 0
3 years ago
Other questions:
  • During interphase, the dna appears as very long strands of dna known as what?
    13·1 answer
  • Many farmers in our area clear their fields every few seasons by burning off the fields. They may choose to rotate crops from ye
    6·1 answer
  • A calico cat has a litter of 8 kittens: 1 yellow male, 2 black males, 2 yellow females, and 3 calico females. What are the genot
    8·1 answer
  • Recently discovered remains from the tugen hills, dated to about 6 million years ago have been placed in which genus?
    11·1 answer
  • Your sister calls you crying because she just hit an animal with her car, and she thinks it was a black-and-white colobus monkey
    5·1 answer
  • What phenomena occur due to these plate movements?<br> 2 sentences or 1 if it explained well
    7·2 answers
  • Natural selection causes changes in? A.genotypes. B.populations. C.individuals. D.phenotypes.
    14·2 answers
  • What strand of DNA would be reproduced from AAC CT
    14·1 answer
  • Which represents a negative impact of technology?
    14·2 answers
  • Which conjugated molecule is weakly acidic and soluble in water
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!