1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina CMI [18]
3 years ago
14

True or false an objects mass is less on the moon than it is on earth

Biology
1 answer:
rodikova [14]3 years ago
4 0
Yes the answer is true
You might be interested in
Cells have specific organelles with different structures and functions. Can you compare the mitochondria and chloroplast in term
Vikki [24]
The chloroplast is found only in plant cells. it is the organelle that conducts photosynthesis, but mitochondria are known as the PowerHouse of the cell, and store energy.
7 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
1. How do fossils form?
noname [10]

Explanation:

There is a LOOOONG process for this so here it is;  

First things first.The animal dies. Soft parts of the animal's body, including skin and muscles, start to rot away. Scavengers may come and eat some of the remains.  Before the body disappears completely, it is buried by sediment - usually mud, sand or silt. Often at this point only the bones and teeth remain.  Many more layers of sediment build up on top. This puts a lot of weight and pressure onto the layers below, squashing them. Eventually, they turn into sedimentary rock.  While this is happening, water seeps into the bones and teeth, turning them to stone as it leaves behind minerals.  This process can take thousands or even millions of years.

I hope this answer helped. Thank you!

3 0
2 years ago
The ribosome is the site of
navik [9.2K]
Ribosomes are where protein synthesis occurs.

B.
6 0
3 years ago
Which question is based on these observations apex answers?
Korolek [52]
Look on the internet please
3 0
4 years ago
Read 2 more answers
Other questions:
  • 1. If an ecologist does a field count of the number of mice in a space that is six hectares, the ecologist is calculating the: p
    7·1 answer
  • Bennett is a male college athlete who participates in endurance activities and weighs 77 kg. approximately how many grams of car
    13·1 answer
  • You're trying to identify a plant, but have no information on its characteristics, other than the fact
    9·1 answer
  • What is a major function of growth hormone?
    5·1 answer
  • The principle of cross-cutting relationships states that certain features-
    15·1 answer
  • Every cell in the body needs oxygen and nutrients in order to perform cellular functions. Which three organ systems interact to
    5·1 answer
  • In fruit flies, a dominant gene, G, codes for the trait of gray body color. A recessive gene, g. codes for black body color. Two
    15·1 answer
  • A condition in the environment that can restrict a population's growth is
    13·1 answer
  • Identify the 4 main types of tissue
    7·1 answer
  • 50 POINTSSSS PLEASE HELPPPPP EASYYYYY
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!