1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
8

Mitosis results in _______, while meiosis results in_______.

Biology
1 answer:
butalik [34]3 years ago
6 0
I answered it before !!

B is the correct one !! Mitosis in two identical diploid and meiosis in 4 genetically varied haploid !!
You might be interested in
Which of the following may display two different grain sizes?
GaryK [48]
 The answer is A:<span> Metamorphic rocks</span><span> may display two different grain sizes.</span>  :)
3 0
4 years ago
What do we call the act of taking something away to increase a behavior?
pashok25 [27]
Negative reinforcement.
8 0
3 years ago
2-In what way is nitrogen important to life on Earth?
Anna007 [38]
I believe all of the above!
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What process is responsible for or leads to magma that is intermediate and often variable in chemistry, when erupted in the casc
ozzi
Intermediate magma is also known as andesitic magmas and these are created when an oceanic plate subducts beneath a continental plate. The magma is generated in the wedge of mantle rock beneath the crust. The Cascade Mountain Range is formed due to the subduction of the Juan de Fuca Plate beneath the North American Plate. 
8 0
3 years ago
Other questions:
  • Both invertebrates and vertebrates, with the exception of the
    14·1 answer
  • When apoptosis occurs, the following takes place EXCEPT for:
    5·1 answer
  • Producers, like this plant, take in oxygen and release carbon dioxide during __________________ , just like animals and other li
    6·2 answers
  • How are watershed scores calculated???
    7·1 answer
  • What does the location of a terminal moraine tell us?
    5·2 answers
  • How do you find per capita growth rate over a month?​
    11·1 answer
  • How is being a groomer related to agriculture
    15·1 answer
  • The membrane structures that make up the cell are called
    11·1 answer
  • In a mass extinction, many species become extinct at the same time. scientists have concluded that a mass extinction killed the
    5·1 answer
  • A nerve is actually a long threadlike bundle of ________ that conduct electrical impulses.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!