1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
9

Amino acids are the building blocks of _____. proteins sugars carbohydrates lipids

Biology
2 answers:
marishachu [46]3 years ago
5 0
Amino acids are the building blocks of proteins. I hope this helps, I'm pretty sure it's proteins! Sorry if you get it wrong.
tester [92]3 years ago
3 0

The amino acids are the building blocks of the proteins.  

Explanation:

The amino acids are the organic molecules made up of a carboxylic group, an amino group and a carbon side chain. The proteins are macromolecules, made up of amino acids. Many amino acids combine to form a protein. The structure of the protein depends on the sequence of the amino acids present in the structure of protein. A different protein has a different sequence of amino acids.  


You might be interested in
Will mark brainliest and give 18 points
Jet001 [13]

Answer:

1.lunar 2.solar 3.earth 4.the moon 5.sun

8 0
3 years ago
Read 2 more answers
Which organism has a single Loop circulatory system <br><br> A.frog<br> B.human<br> C.fish<br> D.dog
coldgirl [10]
The answer is a fish
8 0
3 years ago
Fruit flies have a diploid number of 8, and honeybees have a diploid number of 32. In which case will crossing over have greater
skelet666 [1.2K]
Diploid cells are like daughter cells coming from a mother cell called a haploid cell. So the more daughter cells are born, the greater the chance of getting hybrids and creating more diversity on the genetic races existing. In this case, the answer would have to be honeybees.
6 0
3 years ago
9. People with AIDS are unable to fight multiple infections because the virus that causes AIDS
Rina8888 [55]

Answer:

I think it is (1)

Explanation:

Please give me brainliest :)

4 0
3 years ago
Read 2 more answers
Which list correctly shows carbohydrates in size from smallest to largest?
vovikov84 [41]

Answer:

monosaccharide, disaccharide, polysaccharide

Explanation:

monosaccharide is a basic sugar then goes up from there.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Helppppppppppppppppppppppppppppppppppppppppp me plz!!
    9·1 answer
  • Predict the fur color of the offspring of a brown heterozygous rabbit and a white homozygous rabbit. Brown is dominant and white
    9·1 answer
  • Classification systems
    8·1 answer
  • What does natural selection cause?
    14·2 answers
  • ___________ claims are initiated by the parent and/or child based on the harm suffered as a result of being born.
    13·1 answer
  • After the process of _______ occurs, each daughter cell receives an exact copy of the parent cell's DNA.
    5·2 answers
  • What are three ways cells use to increase ratio and be more effcient
    8·1 answer
  • What are the differences between white blood cells and normal eukaryotic cells?
    15·1 answer
  • What is the important forest? ​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!