1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
2 years ago
9

Amino acids are the building blocks of _____. proteins sugars carbohydrates lipids

Biology
2 answers:
marishachu [46]2 years ago
5 0
Amino acids are the building blocks of proteins. I hope this helps, I'm pretty sure it's proteins! Sorry if you get it wrong.
tester [92]2 years ago
3 0

The amino acids are the building blocks of the proteins.  

Explanation:

The amino acids are the organic molecules made up of a carboxylic group, an amino group and a carbon side chain. The proteins are macromolecules, made up of amino acids. Many amino acids combine to form a protein. The structure of the protein depends on the sequence of the amino acids present in the structure of protein. A different protein has a different sequence of amino acids.  


You might be interested in
Birds are called glorified reptiles.why?​
Anton [14]

Because of their resemblance and relationship to prehistoric reptiles and many people think that birds descended from dinosaurs

5 0
3 years ago
How do mutations work in dna sequences? I'm so lost​
liraira [26]

Answer:

A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is copied or as the result of environmental factors such as UV light and cigarette smoke. Mutations can occur during DNA replication if errors are made and not corrected in time.

6 0
2 years ago
Imagine a large meteor hits earth and causes major flooding,earthquakes,cooler weather, and large waves to shore. What aspect of
Alisiya [41]
Hello!

The 4 major earth science fields are:

Geology: It Is the Study of the composition and internal structure of the planet. A Geologist would examine the earthquakes. 

Oceanology: It is the Study of the seas and oceans, and everything related to it. An Oceanologist would examine the large waves to shore and the major flooding.

Meteorology: It is the study of the dynamics of the atmosphere of the Earth. A Meteorologist would study the cooler weather. 

Astronomy: It is the study of the celestial bodies of the Universe. An astronomer would examine the meteor impact by itself. 

4 0
3 years ago
Read 2 more answers
What is the definition of a heterotroph?
DaniilM [7]

an organism deriving its nutritional requirements from complex organic substances.

4 0
3 years ago
Read 2 more answers
Imagine that part of a population of flies is blown from the California coast to an offshore island. The island flies have no co
Serga [27]

Answer:

Speciation didn't occur over the past 10,000 years

Explanation:

We conclude this, since the two populations could mate (if speciation occurred, there would be no reprodution).

For example, in allopatric speciation which occurs as a result of geographic isolation, the part of population becomes physically separated from the initial main population. There is no gene flow between these two populations and as a result the two populations  reach a high level  of genetic divergence. They can no longer interbreed (reproduction between them) which means they become two different species (speciation).

New populations evolve as result of mutation, genetic drift and natural selection.

4 0
3 years ago
Other questions:
  • Hich statement best describes the relationship of photosynthesis and energy?
    7·1 answer
  • Which word describes the manner in which grendel enters heorot?
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which best describe fetus development?
    8·1 answer
  • 3.<br>Differentiate between green and brown algae.<br>2<br>Describe the clont font​
    6·1 answer
  • Which of the following is a difference between DNA and RNA?
    10·1 answer
  • 1. Blank are the simplest forms of life.​
    10·1 answer
  • All cells need to produce energy in order to survive. On prokaryotes, the energy is produced in the cytoplasm. In eukaryotes, th
    7·1 answer
  • The suncoast tree of northwest Africa is known for 2 traits that are said to show simple dominance. The 2 traits are height and
    11·1 answer
  • Which of these plants are thought to be the first land plants and the main food source for large dinosaurs?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!