1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xenn [34]
3 years ago
5

A client has activated the complement system during an inflammatory response to an injury. when planning care, which information

should the nurse remember about which substance activates complement?
Biology
2 answers:
Inga [223]3 years ago
5 0
<span>Since the client activated the complement system during an inflammatory response, the nurse while nursing him should remember about the antibodies that activates the complement system. These antibodies proteins that are part of immune system that fights with the disease inducing bacteria and virus.</span>
Dvinal [7]3 years ago
4 0
antibodies activate the complement system. a complement system consists of a number of small proteins found in the blood. when an antigen attacks the body, the body responds by producing antibody to that antigen. antibody binds to antigen forming an antibody antigen complex. this complex has the ability to activate compliment system. the end result of activation of compliment system is activation of phagocytes that attack foreign cells in the body. activation of compliment also stimulates inflammation that leads to attraction of more phagocytes.   
You might be interested in
The greatest number of individuals that an ecosystem can support within a population is the
Mashutka [201]

Answer:

Carrying Capacity

Explanation:

The definition of carrying capacity in relation to biology is, "the number of people, other living organisms, or crops that a region can support without environmental degradation."

5 0
3 years ago
Two rabbits mate, one is all dominant (FF) and one is all recessive (ff). The dominant gene is black and the recessive is white.
AURORKA [14]
Two! hope this helps!!
4 0
3 years ago
Read 2 more answers
When an animal runs along the ground by flexing some of its muscles, what causes its muscles to contract?
ira [324]
Letter A for sure! Hope I helped.
8 0
4 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which of these best describes the reason for the very rapid growth of the
pickupchik [31]

Answer:

B. Improved health care, hygiene, and technology

Explanation:

I think that an improved health care system and technologies is helping to reduce the growth of various diseases, the emergence of new treatments and new drugs, which has an impact on the growth of the population.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which organism would probably be the first to grow on a new volcanic island?
    14·1 answer
  • Which of the following statements regarding protein structure is FALSE?A) The primary structure is formed by covalent bonding be
    9·1 answer
  • The moon’s average density is _____.
    12·2 answers
  • What is a special type of fat found in marine mammals that provides insulation?
    14·1 answer
  • What are two types of genes that control the cell cycle and how do they work together?
    15·1 answer
  • Give one characteristic of a peacock that makes it a good competitor, and state what it is competing for using this trait
    5·1 answer
  • At rest the lens of the eye will be more round when the ciliary muscles are contracted true or false
    11·1 answer
  • Giving brainiest
    11·2 answers
  • 5. Should the discovery of alcohol or drug addiction in a pregnant woman lead to
    12·1 answer
  • How did richard neumann and vincenzo beltrone feel about the us government action during wartime?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!