1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
3 years ago
13

Dwarf mistletoes are flowering plants that grow on certain forest trees. They obtain nutrients and water from the vascular tissu

es of the trees. The trees derive no known benefits from the dwarf mistletoes. Which of the following best describes the interactions between dwarf mistletoes and trees? A) mutualism B) parasitism C) commensalism D) facilitation E) competition
Biology
1 answer:
Galina-37 [17]3 years ago
6 0

Answer:

C) commensalism

Explanation:

Commensalism is an interaction in which one organism benefits without causing any harm to the other. The other organism derives no benefit from the relationship.

The scenario above in which the dwarf mistletoe obtains nutrients from the vascular tissues of trees is a perfect example of such a relationship.

Parasitism is similar to this but the other organism is harmed in the process.

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
A species of fly has two alleles for the length of their legs. The allele for long
Artyom0805 [142]
The answer is A. 0.54.

In a population p+q=1 (we have 2 alleles only).

The question states that 0.21 of the population(21%) have short legs meaning they are q^2.

So q=rad0.21=0.4582.

And p=1-q=0.5417.
3 0
2 years ago
Read 2 more answers
A plant with white flowers was crossed with a plant with red flowers. All of the offspring had pink flowers. Which of these term
Vedmedyk [2.9K]
D, incomplete dominance

5 0
3 years ago
Read 2 more answers
Wich organism is and example of a producer<br> Moth<br> Mushroom<br> Rose<br> Cheetah
Rudiy27
Rose is an example of a producer.
5 0
3 years ago
Read 2 more answers
Each of two parents has brown eyes. They have four children. If three of the children have brown eyes and one has blue eyes, whi
Kazeer [188]

Answer:

C, Both parents have the blue-eyed gene.

7 0
2 years ago
Other questions:
  • Which factor contributed most to the extinction of many species?&gt;
    7·1 answer
  • When under the influence of hypnosis, people are most likely to __________.
    10·2 answers
  • The deadliest of all mass extinctions, which killed 95% of all living organisms, was the _____.
    10·2 answers
  • Why, Tommy, oh why? Your ever-returning patient has fractured his femur really badly. This is going to be a lot of work. Can you
    13·2 answers
  • Take two glasses, fill one with water and leave the other empty. Place them side by side. Fold a paper towel lengthwise and put
    8·2 answers
  • In this assignment, you will use your knowledge of the central nervous system to answer a few questions. You then will explore t
    12·2 answers
  • The effects of point mutations on polypeptides Point mutations are those that alter a single base pair or base location, and inc
    10·1 answer
  • 8 A cell uses active transport to move molecules across a cellular membrane when
    10·1 answer
  • Which was ventures contribution to science
    15·1 answer
  • Discuss how the body changed?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!