1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alik [6]
3 years ago
13

Which of the following would be one way a farmer could increase the amount of available nitrogen in his fields without adding a

synthetic fertilizer?
Grow a legume crop to support the development of root nodules.
Flush the field with water.
Burn unwanted plants on the field.
Add nitrogen gas to the fields.
Biology
2 answers:
katovenus [111]3 years ago
4 0

The correct answer is:

Grow a legume crop to support the development of root nodule

The best way that a farmer could increase the amount of nitrogen in his fields without adding synthetic fertilizer is to grow a legume crop to support the development of root nodules. This is because legumes have a symbiotic relationship with bacteria found in the soil. 

Explanation:

Legumes use nitrogen fixing bacteria, specifically symbiotic rhizobia bacteria, within their root nodules to counter the limitation.The plant root cells convert sugar into organic acids which then supply to the rhizobia in exchange, hence a symbiotic relationship between rhizobia and the legumes.

Elenna [48]3 years ago
4 0
The best way that a farmer could increase the amount of nitrogen in his fields without adding synthetic fertilizer is to grow a legume crop to support the development of root nodules. This is because legumes have a symbiotic relationship with bacteria found in the soil. 
You might be interested in
Fill blanks with:N−Cα−C N − C α − CCα−C C α − CN−Cα N − C αbackboneside chaina stable secondary structurea stable tertiary struc
polet [3.4K]

Answer:

Explanation: see attachment below

3 0
3 years ago
What happen to dory when she tries to enter the anemone
Umnica [9.8K]

Answer:

She dies

Explanation:

She should not venture out into the wild.

6 0
3 years ago
Read 2 more answers
Members of which of the following groups have an
Grace [21]
Sea stars or starfish
7 0
3 years ago
IF SOMEONE ANSWERS THESE TO QUESTIONS CORRECTLY THEY GET BRAINLIST!!!!!!!!!!Which of the following is NOT a way that humans main
DiKsa [7]

Answer:

1. Cutting their hair

2. Attracting a mate

Explanation:

6 0
4 years ago
A carbohydrate molecule is
spin [16.1K]
The answer is b I'm positive 

pls give brainliest answer
8 0
3 years ago
Read 2 more answers
Other questions:
  • What of the following is most likely to occur if an organism’s environment is outside the organism’s range of tolerance?
    15·1 answer
  • Any movement of carbon between carbon reservoirs is called a
    8·2 answers
  • Which of the following conditions favors "big-bang" reproduction?a. high rate of offspring survivalb. intense inraspecific compe
    12·1 answer
  • What is the main function of the digestive system
    15·2 answers
  • For each of the following scenarios, state the type of inheritance (20 points) and explain how you are able to discern this info
    9·1 answer
  • An important factor in Oswald Avery's ability
    13·1 answer
  • Suggest some method to<br>presevining forest habitan​
    9·1 answer
  • Please answer this question:)​
    8·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • How did the mutation change the hemoglobin protein?<br><br><br><br> ASAP
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!