1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
7

A sense organ is made up of ______ and other cells that help gather information

Biology
2 answers:
erica [24]3 years ago
6 0
The answer is sensory nuerons
Vlad [161]3 years ago
6 0

Answer: The correct answer for the blank is -

Sensory neuron.

Explanation:

Sense organs can be described as organs or parts of the body that are sensitive to or responds to any change in the environment (external stimuli such as light, heat, chemical, vibration etc ) and convey messages in the form of nerve impulses to the central nervous system through sensory neurons.

Thus, they are made up of sensory neurons and other cells that help in gathering information, which is then passed to the CNS.

You might be interested in
PLEAe help mE ASAP ASAP
joja [24]
Organ system is the answer
8 0
3 years ago
Read 2 more answers
Which body system or structure is responsible for the control and regulation of a person's breathing?
Elanso [62]

Answer: Nervous system

Explanation:

The cerebellum of the brain is the structure of the nervous system known to control various muscles of the body that are involved in involuntary activities such as breathing.

Thus, the nervous system controls and regulates a person's breathing

8 0
3 years ago
ASAP What is the main negative effect of slash and burn deforestation in rain forests?
asambeis [7]
4. How can managers strike a balance between transactional and transformational leadership?
an advantage to a business organization
3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What is binomial nomenclature ?
Gemiola [76]
It's the naming/classifying system
The first word in it is the genus and the second word is the species. The first letter in the genus has to be capitalized and both words have to be underlined
4 0
3 years ago
Read 2 more answers
Other questions:
  • Organisms in this kingdom are multi-celled, cannot move, and get their energy by decomposing dead matter.
    15·1 answer
  • Why does compact bone have canaliculi, but spongy bone does not?
    8·1 answer
  • Energy for the cell’s use is stored when?
    5·2 answers
  • why is it important that ions being transported across a cell membrane be shielded from the interior of the lipid bilayer
    13·1 answer
  • Cells produced by the root and shoot tip meristems become the tissues of the plant body.
    15·2 answers
  • The days and nights are always of equal time throughout the year at the equator. True False
    12·1 answer
  • Why can't DNA leave the nucleus?<br> Because that will risk it getting damaged
    9·1 answer
  • How are intermediates of these pathways converted into lipids for energy storage during the long light?
    5·1 answer
  • Please can someone please answer the question it’s already past due
    15·2 answers
  • Plants,protists,animals and fungi are made up of cells. true or false?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!