3 years ago

There are 30,000 genes are on a single chromosome

1 answer:

Nookie1986 [14]3 years ago

3 0

Your answer is Each pair of chromosomes contains a different set of genes, and together they make up the genome. To put it another way, the current estimate is that the human genome contains about 30,000 genes. These are distributed over 23 chromosome pairs.

You might be interested in

Characteristics such as eye color, that are passed from one generation to the next, are known as ______.

SpyIntel [72]

Answer:heredity

Explanation:something that’s passed on to some members

5 0

2 years ago

Read 2 more answers

The kinetochore is a structure that functions to a. connect the centromere to microtubules. b. connect centrioles to microtubule

olchik [2.2K]

Answer:

Connect the centromere to microtubules. (Option A)

Explanation:

The kinetochore is known as the complex of protein which is disc shape in structure. The structure of kinetochore is divided into three parts: inner region, outer region, and fibrous corona. Each part of the kinetochore works in its own way in the separation of the sister chromatids.

During the process of cell division (mitosis, and meiosis) kinetochore collects on the centromere and allows the chromosome to link with microtubules.

8 0

3 years ago

Read 2 more answers

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

I need to turn this into a food chain, but after land plants there’s 2 so do I write both or just one?

frez [133]

Answer:

heron and perch or fox they are

8 0

2 years ago

UNO [17]

Yes! they would be your aunt and uncle!

8 0

3 years ago