All categories

2 years ago

1. Describe soil particles (sand, silt, and clay) in term of size and texture.

Biology

1 answer:

Y_Kistochka [10]2 years ago

6 0

Answer:

Sand particles are the largest and range from 2.0 to 0.05 mm in diameter. Silt particles are smaller, ranging from 0.05 to 0.002 mm. Clay particles are smaller than 0.002 mm. Texture affects other soil properties such as bulk density, water holding capacity, permeability, and porosity.

Explanation:

You might be interested in

Which of the following has the element correctly matched with its description?

BlackZzzverrR [31]

Hello. This question is incomplete. It is important that you always provide all the information so that your question can be answered the way you deserve.

The full question is:

"Which of the following has the element correctly matched with its description?

The duodenum is the first section of the small intestine and contains Peyer's patches.

The bile moves upward and backward and pushes the bolus

The bones attaches the liver to the anterior abdominal wall

Tongue toxins prevent water absorption in the large intestine"

Answer:

The duodenum is the first section of the small intestine and contains Peyer's patches.

Explanation:

It is true that the duodenum is the first section of the small intestine where Peyer's patches are located. The duodenum is the place where most of the entire digestive process occurs, in addition, it allows food to mix with bile and digestive juices.

Peyer's patches play an important role in immunological surveillance during digestive processes. This is because it allows the destruction of possible pathogens associated with food, or that interfere with digestion in some way.

3 0

3 years ago

Grasslands typically do not flourish when large herbivores are removed. In fact, they are soon replaced by broad-leaved herbaceo

JulijaS [17]

Answer:

Grasslands and herbivores have a mutually beneficial symbiotic relationship. If larger herbivores such as Kangaroos and Elephants are removed from them, they may become extant.

Explanation:

Herbivores are always hungry and they are always looking for ways to replenish lost energy. Between tree shoots and grass, they often go for the former because they are tender, easier to reach, and less difficult to masticate than the young tree shrubs.

When baby trees become bigger, their shade prevents adequate sunlight from reaching the grass, then gradually they become scanty or subdued for as long as the shade remains.

When large herbivores are removed or leave a grassland, trees have the ability to flourish. Then the results indicated above happens.

Cheers!

6 0

2 years ago

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

What is 48% expressed as a fraction in simplest form?

Gekata [30.6K]

In order to turn percent to a fraction, first, we write it as 48/100. Then, from there we simplify it to the simplest form.

48/100 = (48/4) / (100/4) = 12/25

So, 48% expressed as a fraction in simplest form is 12/25.

3 0

3 years ago

Read 2 more answers

Which statement about stomata is true?

dedylja [7]

Answer:

stomata are tiny pores present on a surface of leave which helps in exchange of gases

7 0

3 years ago