Answer: d. Predators avoid prey that are in their prime in order to maintain a high reproductive rate in the prey population, and hence 'grow' prey for the future.
Explanation:
A predator can be define as an organism superior and strong enough to kill inferior and weaker organism. This organism kill other organism to obtain it as food. A prey is an organism which is weak and cannot defend itself from the attack of the superior organism.
d. is the correct option. This is because the predators do not bother about the age and strength of the prey. They attack over them whether the prey is weak , young, prime, or old and try to obtain it as food.
Improper agricultural methods may elevate concentrations of nutrients, fecal coliforms, and sediment loads. increased nutrient loading from animal waste can lead to eutrophication of water bodies which may eventually damage aquatic systems.
The most obvious pattern is that A binds with T and C with G, as is the case with DNA.
It should be
AGATACCATGGTTACCCGGTTCCA
