1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arsen [322]
3 years ago
15

the_______ explains inheritance resulting in two dominant alleles being expressed in the offspring, with neither trait being mas

ked.
Biology
2 answers:
sashaice [31]3 years ago
4 0
It is a case of CODOMINANCE where the two alleles are expressed
rjkz [21]3 years ago
3 0

Answer:

Codominance

Explanation:

Codominance is a type of inheritance where both alleles are expressed simultaneously. Alleles most times are not always fully dominant to each other, but in codominance, the two alleles for a trait are both dominant. In codominace non of the allele can mask the trait of another allele, and the two alleles are always expressed in the offspring.

From the question, we can now say that the codominace explains inheritance resulting in two dominant alleles being expressed in the offspring, with neither trait being masked.

You might be interested in
Mendel’s principle of segregation reflects what event in meiosis?.
frutty [35]

Answer:

during meiosis alleles segregate

Explanation:

ther can be more than one type of allele for a gene

4 0
2 years ago
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
How organelles work together to help maintain the cells homostasis ?
Bumek [7]
The nucleus helps to regulate the functions of other organelles. Helps to regulate specialized functions and preform specific roles is the answer I believe
3 0
3 years ago
A farmer had an accident and spilled a chemical into his pond. Several days later, he notices many dead frogs around the pond. T
zlopas [31]

Hey there!

Here is your answer for this question.

Answer : <em>B. the Frogs are a limiting factor for the gnats. </em>

I hope this helps you! Please let me know if you need anymore help on anything you are struggling with!☺

5 0
3 years ago
Read 2 more answers
In the nitrogen cycle, different forms of nitrogen move through all of Earth’s subsystems. Which step in the nitrogen cycle show
arsen [322]

Answer:

B, that is, nitrogen-fixing bacteria in the soil convert nitrogen from the air to make nitrates.  

Explanation:

As we know, Nitrogen cycle hold alot of importance in earth's geology because it moves the Nitrogen from soil to the atmosphere and then back to the biosphere fulfilling the Nitrogen needs of animals as well as plants.

Just like all other biogeochemical cycles,  there are different stages of Nitrogen cycle through which an interchange of nitrogen between different reservoirs occur.

The Nitrogen present in the atmosphere is not usable for the animals and plants. However, there are some bacteria present in the soil called nitrogen-fixing bacteria that convert the atmospheric nitrogen to a usable form called nitrates. Plants are able to use these Nitrates and fulfill their nitrogen demands as nitrogen is the main component of the chlorophyll - molecule that makes photosynthesis possible.

Therefore B is the appropriate option.

Hope it help!

4 0
3 years ago
Other questions:
  • Succulent plants such as aloes are known for their thick stems and leaves, which allow them to store water. Which statement best
    10·1 answer
  • (( EARTH SCIENCE ))
    15·2 answers
  • Which cell uses energy
    12·2 answers
  • The relatively long half-life of lipid-soluble hormones (steroid hormones) compared to water- soluble hormones is due in part to
    8·1 answer
  • What could have caused this situation?
    10·1 answer
  • The remain of which organism are most likely to leave a fossil
    11·1 answer
  • An osteon is the smallest funtional unit of bone and is made up of layers called ________________.
    8·1 answer
  • The pedigree shows shaded individuals who display the trait for brown eyes which is
    7·1 answer
  • Which of the following statements about organelles is NOT true?
    13·1 answer
  • Are scorpions producers, herbivores, carnivores, scavengers, or decomposes?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!