Answer:
during meiosis alleles segregate
Explanation:
ther can be more than one type of allele for a gene
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
The nucleus helps to regulate the functions of other organelles. Helps to regulate specialized functions and preform specific roles is the answer I believe
Hey there!
Here is your answer for this question.
Answer : <em>B. the Frogs are a limiting factor for the gnats. </em>
I hope this helps you! Please let me know if you need anymore help on anything you are struggling with!☺
Answer:
B, that is, nitrogen-fixing bacteria in the soil convert nitrogen from the air to make nitrates.
Explanation:
As we know, Nitrogen cycle hold alot of importance in earth's geology because it moves the Nitrogen from soil to the atmosphere and then back to the biosphere fulfilling the Nitrogen needs of animals as well as plants.
Just like all other biogeochemical cycles, there are different stages of Nitrogen cycle through which an interchange of nitrogen between different reservoirs occur.
The Nitrogen present in the atmosphere is not usable for the animals and plants. However, there are some bacteria present in the soil called nitrogen-fixing bacteria that convert the atmospheric nitrogen to a usable form called nitrates. Plants are able to use these Nitrates and fulfill their nitrogen demands as nitrogen is the main component of the chlorophyll - molecule that makes photosynthesis possible.
Therefore B is the appropriate option.
Hope it help!