1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anuta_ua [19.1K]
3 years ago
9

Why might scientists who study changes of state build models showing the arrangement of particles in a substance?

Biology
1 answer:
Goryan [66]3 years ago
7 0
<span>Models can be very helpful in describing the different arrangements of atoms or particles and their interactions with one another as a substance changes state. It can be very useful to have an item that demonstrates how a crystalline material forms a lattice and how its internal alignment changes as in passes from a solid into a liquid phase.</span>
You might be interested in
In the Cori cycle, when glucose is degraded by glycolysis to lactate in muscle, the lactate is excreted into the blood and retur
Kaylis [27]

Answer:

Question is incomplete i have added full question with explanation and reaction see attachment.

3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
In the lab, Celia adds concentrated sulfuric acid to a beaker full of water. She touches the side of the beaker and finds the so
AlladinOne [14]

Answer: The statement is false

Explanation:

Addition of concentrated sulfuric acid (H2SO4) to a beaker full of water (H2O) will release heat energy to the containing vessel due to the breakage of strong ionic bond present in the acid.

Thus, it is an evidence of a EXERGONIC REACTION (since energy is released spontaneously). So, the statement is false

8 0
4 years ago
Quick
Viktor [21]

Answer:the organelle which are found in both animal and plant cells are

Cell membrane

Cytoplasm

Nucelus

Golgi bodies

Ribosome and

Vacoule ( in different amount)

3 0
3 years ago
Assume the light wave directed at the paper is white light and the paper reflects the wavelengths of red-orange-yellow-green-blu
Tanzania [10]
If you apply white light and it reflects only red, you see it red, all the other wavelentghs absorbed. If it reflects all wavelength (i think listed all red-orange....) then it should be white.

3 0
3 years ago
Read 2 more answers
Other questions:
  • An enzyme is subject to allosteric regulation . how would you design an inhibitor of the enzyme that was competitive? non-compet
    6·1 answer
  • In a food chain, energy flow begins with_
    10·2 answers
  • Use the cell theory to explain why a stuffed animal dog is not alive
    12·1 answer
  • In muscle the source of a "phosphate molecule needed to recharge an adp molecule to an atp molecule" is
    10·1 answer
  • The difference between the levels of ocean water at high and low tide is called
    14·1 answer
  • Cell like this has just left the lungs. What colour will it be?
    13·1 answer
  • Help me please!<br> In your own words, what are the differences between the plant and animal cell?
    15·1 answer
  • In the absence of oxygen, glycolysis is followed by _________ in human cells
    8·1 answer
  • What is the density of a mineral used for?
    6·1 answer
  • A __________________ allows hydrogen ions to flow across the inner mitochondrial membrane.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!