People with diabetes often receive insulin injections. What effect does insulin have on the body?

Biology

2 answers:

Gennadij [26K]3 years ago

8 0

The right answer is B.

Insulin is a hormone naturally secreted by the pancreas, specifically by specialized cells located in the islets of Langerhans. It allows glucose (sugar) to pass blood into the cells of the body. These will use glucose as energy or store it for future use.

In healthy subjects, insulin is secreted continuously. The body produces insulin according to the needs and foods consumed. For example, after a meal, the pancreas secretes additional insulin, allowing blood glucose to stay within normal limits.

Dafna1 [17]3 years ago

8 0

Answer:

Explanation: I took the test and past it

You might be interested in

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved