1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
4 years ago
8

How do introduced species become established in a new ecosystem? Check all that apply.

Biology
2 answers:
Fed [463]4 years ago
7 0
The answer is 1,3,4,6,8.
Yanka [14]4 years ago
7 0

How do introduced species become established in a new ecosystem? Check all that apply.


introduced to a habitat similar to their own


introduced to a habitat different than their own


outcompete native species


generally have no native predators


generally have native predators


often have high reproductive rates


often have low reproductive rates


can tolerate a range of conditions


You might be interested in
The maximum number of wolves that can survive in a particular forest is 230. What is this number called?
katrin [286]

Answer:

B. carrying capacity

Explanation:

Definition of carrying capacity; the number or quantity of people or things that can be conveyed or held by a vehicle or container.

7 0
3 years ago
What type of cell helps to stimulate b cells to produce antibodies?
valentinak56 [21]
The correct answer is helper T cells.
<span>The helper T cells are one of the main cells of the adaptive immune system. Their role is to help the activity of other immune cells by releasing T cell cytokines and they are required for almost all adaptive immune responses. The helper T cells activate B cells to secrete antibodies, stimulate macrophages to destroy ingested pathogens, and help in activation of cytotoxic T cells to kill infected target cells.</span>
3 0
3 years ago
How is diversity in a population created?​
Lemur [1.5K]

Answer:

I don't know what type of diversity, but I know genetic diversity

Explanation:

genetic diversity is controlled by 4 processes. mutation, drift, migration and selection. each of them have a analogue at the level of species. speciation creates new species much as mutation creates new alleles

4 0
4 years ago
Read 2 more answers
What results from the removal of a phosphate group from atp? the release of energy the creation of energy the absorption of ener
mel-nik [20]
the release of energy
4 0
3 years ago
You isolate chromosomes from the salivary gland of an organism and prepare a glass slide of the chromosome preparation. When you
vredina [299]

Answer: the name used is polytene chromosomes.

Explanation:

Polytene chromosomes are produced when repeated rounds of deoxyribonucleic acid (DNA) replication without cell division forms a giant chromosome, they have thousand of DNA strands and provides high level of function in the salivary glands.

At interphase, polytene chromosomes are seen to have distinct thick and thin banding patterns, these bands are of 2 types, the dark band (dark stained,

contains more DNA and less RNA) and the interband (light stained, more RNA and less DNA). The bands enlarge and forms a swelling called puff in certain times, the puffing (which is the formation of puff) is caused by the uncoiling of individual chromomeres in a band. The puffs indicate the site of active genes where mRNA synthesis takes place. These distinct banding patterns are used to study the function of genes in transcription because they permit high level of gene expression.

4 0
4 years ago
Other questions:
  • What conditions in the graph are most strongly linked to gene?
    8·1 answer
  • Why do you think athletes often eat lots of carbohydrates before the day of compition?
    9·1 answer
  • What are the three elements found in all sugars?
    5·1 answer
  • Is this a vascular plant or non vascular plant?
    8·2 answers
  • Nucleotides in RNA are connected to one another in the polynucleotide chain by A. covalent bonds between bases. B. covalent bond
    8·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Which of these best compares the conditions at Location X and Location Y?
    15·1 answer
  • An organisms haploid number if its diploid number is 32?
    11·2 answers
  • which statement best explains why people with cancer due to asbestos exposure do not pass the mutation on to their offspring
    14·2 answers
  • Variables and controls are chosen during which step of scientific inquiry?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!