1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bumek [7]
3 years ago
14

Which of the following BEST describes why a lender might offer more money and lower interest rates to an individual with a high

paying, full time job?
A. They are more likely to make late or miss payments
B. They likely have friends and family that can help them repay the loan
C. Having a high salary means that they are a responsible person
D. Their income makes the lender comfortable that they will be able to repay the loan
Biology
1 answer:
Alex3 years ago
8 0

Answer:

my guess would be D

Explanation:

It could be C too, but I think D is a better answer

You might be interested in
When you replicate 1 DNA molecule, you end up with *
Nina [5.8K]

Answer:

2 DNA molecules that are identical from each other

5 0
4 years ago
A race car driver loses his leg in an accident. Apply Lamarck's and Darwin's theories of evolution to predict whether this disab
Dvinal [7]
The disability won't be passed onto his children because it(the disability) is not a genetic defect.
It was caused by an accident not passed on by his mother or father.
8 0
4 years ago
According to the cladogram, which of these organisms appeared before all the others?
9966 [12]
In a cladogram the tiny indentations along the bottom line is an evolution or change and every organism after the indentation on the bottom line has it and every organism before the indentation does not
3 0
3 years ago
A ridge of sand projecting into a bay and often having a hooked and is a
andrew11 [14]
A ridge of sand projecting into a bay and often having a hooked and is a _.

Split
7 0
4 years ago
Explain what a second messenger molecule’s role is in signal transduction, and give an example. Describe how signal information
olya-2409 [2.1K]

Answer:

cAMP, IP3, cGMP, DAG and cAMP are the second messengers.

Explanation:

The extracellular factors act as the first messengers. These are usually hormones and neurotransmitters. The neurotransmitters like serotonin, growth hormone and epinephrine. The second messenger depends on the signals received by cell surface receptors. The cAMP, IP3, cGMP, DAG and cAMP are the second messengers. The secondary messenger target molecules present in nucleus and cytoplasm.

The signal information is transduced into cellular responses in the cytoplasm and nucleus with the change in receptor. This leads to the activation of signaling cascade.  

5 0
4 years ago
Other questions:
  • A region experiences frequent landslides from heavy rains. How can the local residents lower the frequency of landslides in the
    13·2 answers
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Biologists recognize the following levels of cell organization: _____.
    15·2 answers
  • How does over-hunting cause a species’ population to decrease? A. Most of the surviving individuals move away. B. Too few indivi
    6·2 answers
  • Name an organ found in a human.list three tissue which make up this organ
    7·1 answer
  • Which substance is a nucleic acid? amino acid fat polysaccharide RNA
    5·2 answers
  • What is the reason behinWhich is the definition of adhesion?d the high surface tension of water?
    5·1 answer
  • Evolution assessment tibetan plateau
    14·1 answer
  • What mutation happens when a gamete is forming?
    7·1 answer
  • PLEASE HELP In codominance _____.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!