1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
satela [25.4K]
4 years ago
6

Increased pressure in the ventricles would close what valve(s)?

Biology
1 answer:
bekas [8.4K]4 years ago
3 0
It would cause the atrioventricular ( bicuspid and tricuspid) valves to close
You might be interested in
[BWS.03]Scientific laws are
melomori [17]

Answer:

scientific laws are descriptions of specific relationships under given conditions in the natural world

3 0
2 years ago
Should mild traumatic brain injury patients be tested for cognitive deficits in the emergency department?
Dmitriy789 [7]
The answer to your question is yes.
4 0
3 years ago
Many of our basic biological functions, such as breathing, exist at the __________ level. A. preconscious B. nonconscious C. unc
NikAS [45]

The answer is B. Nonconscious level.

4 0
3 years ago
Read 2 more answers
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Which of the following describes how Earth's atmosphere changed during Precambrian time?
WINSTONCH [101]

Answer:

c

Explanation:

8 0
3 years ago
Other questions:
  • Which type of rock usually underlies a karst landscape?
    14·1 answer
  • The best description of the greenhouse effect is that it _______.
    12·2 answers
  • What are two ways water travels from land to enter the ocean
    10·2 answers
  • The researchers also found that after 150 days, the relative change in virulence of B. thuringiensis was greater than the relati
    12·1 answer
  • Carrot slices placed in 0.2M salt solution for several hours becomes flaccid (limp). Carrot slices placed in freshwater for seve
    9·2 answers
  • Surrounding the central bulge, this spherical region of a galaxy is known as
    11·1 answer
  • The female is born with about _______ immature sex cells.
    10·2 answers
  • How is pitch and intensity related?
    13·2 answers
  • Which employees typically work in an office environment within schools? Check all that apply
    11·2 answers
  • PLEASE HELP WILL GIVE BRAINLIEST What would happen to a plant if the chloroplasts in its cells became damaged?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!