1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
12

This graph shows how the lynx and snowshoe hare populations can vary over time. How would the lynx population change if a diseas

e killed most of the snowshoe hares?

Biology
2 answers:
blondinia [14]3 years ago
5 0
The lynx population would decline with that of it's food source due to increased competition.
katovenus [111]3 years ago
5 0
The population of lynx would slowly decrease due to less food sources due to increased competition among the species.
You might be interested in
What percent of the organisms genetic information is the same as the genetic information of the parent PLEASE HELP FASSTTTTT
Sophie [7]

Answer:

Every person has two copies of each gene, one inherited from each parent. Most genes are the same in all people, but a small number of genes, which is less than one percent of the total are slightly different between people.

Explanation:

6 0
3 years ago
Which organelle is most prominent when looking at cheek cells under the microscope?
SpyIntel [72]
<span>Nucleus. Would be your answer</span>
8 0
3 years ago
A science club has 16 members. How many ways can a president, a vice president, and a treasurer be selected from the members?
boyakko [2]

Answer:

The answer would be D. 3,360

Explanation:

The solution is found by multiplying 16 times 15 times 14. The club has 16 members and after one role (president) is filled, there are 15 left to fill the next (vice). The same goes for the next role (treasurer). So 16 is multiplied with 15, then 14. This is more of a math question that biology btw.

3 0
3 years ago
An earthquake has a high magnitude but a low intensity. Which statement best explains this?(1 point)
Lera25 [3.4K]

Answer:

Magnitude and Intensity measure different characteristics of earthquakes. Magnitude measures the energy released at the source of the earthquake. Magnitude is determined from measurements on seismographs. Intensity measures the strength of shaking produced by the earthquake at a certain location.

Explanation:

i hope it helps

6 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • Clara is meeting with a new client. She enters the conference room with her head high. She shakes the client's hand and smiles.
    13·1 answer
  • Which structure is not part of endomembrane system
    5·2 answers
  • What is the process of the endomembrane system? (Simply please)
    15·1 answer
  • Which of the following is not a mechanism of microevolution?
    12·2 answers
  • A cell speedn aqqroximately _____ of its cycle in the M phase. 10%,30%,60%,90,%
    15·1 answer
  • 1. Some bacteria in the colon help in making vitamin K. What is the
    10·1 answer
  • What is this? Please answer with an explanation
    13·2 answers
  • The following statements refer to a comparison of reproduction in ferns vs. flowering plants. Indicate whether each statement is
    14·1 answer
  • (SOLVED!!) Which of the following examples best describes an organism's niche?
    5·1 answer
  • What is A loss of an electron during a chemical reaction
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!