1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Taya2010 [7]
3 years ago
14

Which of these components of a cell functions like the bones and muscles in the human body?. . A. chloroplasts. . B. ribosomes.

. C. cytoskeleton. . D. cytoplasm.
Biology
2 answers:
Reptile [31]3 years ago
5 0
"Cytoskeleton" is the component among the components <span>of a cell functions like the bones and muscles in the human body. he correct option among all the options that are given in the question is the third option or option "C". I hope that the answer has come to your help.</span>
Strike441 [17]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The bones and muscles in animal cells form the framework of the body or the skeletal system of the body.

The molecules which form the framework or act as the skeletal system of the cell are known as the cytoskeleton.

The cytoskeleton consists of three types of structures called microtubules, intermediate filaments and the micro-filaments.  They all play an important role as they maintain the structural integrity of the cell as well as in the various process of the cell-like cell division.

Thus, Option-C is the correct answer.

You might be interested in
A new food product is being distributed by a company. Researchers determine that the food product contains only carbon, oxygen,
Contact [7]

Answer:

This new food is a carbohydrate

Explanation:

<em>Carbohydrates (also known as saccharide) general formula is CH2On, this means they are molecules that only contain carbon (C), hydrogen (H) and oxygen (O). </em>In the basic form, these sugars are known as monosaccharides, they can combine no form more complex sugars like disaccharide (2), oligosaccharides (2-10) or polysaccharides (>10).

Therefore we can conclude that this new food is a carbohydrate.

I hope you find this information useful and interesting! Good luck!

3 0
3 years ago
Para a ocorrência de osmose, é necessário que (analise as afirmações a seguir e marque como resposta a soma dos itens corretos u
mixer [17]

Answer:

(08) and (32)

Explanation:

To make osmosis happen there has to be a difference in the concentration of solutes, between the inside and the outside of the cell. To valance this difference in concentration, water has to flow towards a place that has a higher number of solutes.

The lipids in the cell's wall make this membrane semipermeable. This allows the passage of specific components only, such as water through aquaporins. Lipids and other elements are of importance in the barrier because they maintain the cell separated from the outside, allowing it to be balanced as regards the different substances that can interact with it.

6 0
3 years ago
50 POINTS GIVING BRAINLIEST ALSO!!!!!
nikklg [1K]
"two ages o'er his native realm he reign'd"

0 0
3 years ago
Read 2 more answers
Hearing loss that occurs as a function of age is called _____.​
Elena L [17]
Hearing loss that occurs as a function of age is called presbycusis.

In presbycusis, the patient will lose the ability to hear the higher frequency of sound. 
Anosmia is losing the ability to smell. Presbyopia is vision loss that occurs as a function of age.
6 0
3 years ago
Which of the following does not have an effect on enzyme activity?
ziro4ka [17]
Shape of active site
8 0
2 years ago
Other questions:
  • How does the structure of cholesterol enable it to perform structural and functional roles within membranes
    8·1 answer
  • John, an african american student, has chosen to incorporate exercise into his daily routine and to reduce the amount of salt in
    9·1 answer
  • What type of bond is shown below, where a weak bond is formed between partially charged molecules that contain hydrogen atoms?
    5·2 answers
  • If the concentration of hydrogen ions (H+) outside the thylakoids were equal to the concentration of H+ inside the thylakoids, h
    12·2 answers
  • Difference between DNA and Chromosome
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • 1. What are the two main groups of minerals?
    11·1 answer
  • An organ composed mainly from epithelial and nervous tissues converts vibrations into impulses that are sent to the brain . Whic
    12·1 answer
  • Patty makes a table of the symbols used for the parts of an electric circuit. A 2-column table with 4 rows. The first column lab
    5·2 answers
  • 11. Fossil fuels are considered nonrenewable resources because of -
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!