1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
3 years ago
14

Jessica recently moved to an apartment in the industrial area of Readington City. She noticed that the roads in her neighborhood

warm up quickly. She also noticed that the temperature in her apartment is typically much warmer than the temperature of her previous apartment, which was near the mountains on the outskirts of the city. What is responsible for the change in temperature?
Biology
2 answers:
Zarrin [17]3 years ago
7 0

Answer:

Urban Heat

Explanation:

Urban heat is defined as the heat or the increase in temperature that occurs in an urban area due to the anthropogenic activities. These anthropogenic activities include the release of harmful toxic gases from the vehicles, factories and industries, burning up of fossil fuels and from other sources. Deforestation also is another reason for this increasing temperature because the trees were cut down in order to construct houses and other commercial buildings, as a result of which the heat is absorbed by the land surface at a much higher rate. The temperature in this region is comparatively much higher than the surrounding rural areas.

Thus, urban heat is responsible for the change in temperature.

Daniel [21]3 years ago
5 0

Answer:

Urban heat

Explanation:

Urban heat is a terminology generally used to describe the higher temperature with in the cities as compared to the surrounding woods.

Jessica moved to industrial area which has large industries that continuously release heat and pollution in the environment. Due to this the environment in and around the industrial area is much warmer as compared to the outskirts of the cities (with mountains).

Also the cities have offices & residential apartments, traffic and automobiles that continuously release heat and pollution thereby further enhancing the temperature of cities.

You might be interested in
The carbon cycle involves a variety of processes that move and convert carbon between Earth systems. The diagram summarizes the
jolli1 [7]

Answer:

I think its C because it releases carbon

3 0
3 years ago
The ________ is the decorated niche inside a mosque that indicates the direction of Mecca.
Aneli [31]

Answer:

The correct answer to the following question will be "Mihrab".

Explanation:

  • A semicircular niche throughout the wall of a mosque showing the qibla; that is, the direction of the Kaaba in Mecca, and hence the way that Muslims will face while they pray. Thus the wall into which a mihrab appears was the "qibla wall."
  • A chanter calling for people to pray. Fana is a religious figure; in fact, a few of Muhammad's hereditary predecessors, worshiped in Shiite Islam.
  • It is traditional, when entering a mosque, to remove somebody's shoes and put them on the entrance rack. This is accomplished out of respect and also to avoid soiling the interior floor of the prayer hall — prayer halls do not have chairs or benches, just row after row of carpets, aligned to face the holy sites of Mecca in Arabia.
8 0
2 years ago
Read 2 more answers
Please help<br> Explain how independent and dependent variables apply to life
Crazy boy [7]

Answer:

If one wants to estimate the cost of living of an individual, then the factors such as salary, age, marital status, etc. are independent variables, while the cost of living of a person is highly dependent on such factors. Therefore, they are designated as the dependent variable.

4 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
In a cross aabbcc x aabbcc, what is the probability of producing the genotype aabbcc?.
Anni [7]

Answer:

1/8

Explanation:

Traditional method of solving this problem can be by using the punnett square.

3 0
2 years ago
Other questions:
  • DNA can be found in what 2 organelles?
    10·1 answer
  • 1. List 3 types of cephalopods.
    9·1 answer
  • The amount of energy the atmosphere absorbs depends in part on its level of
    13·1 answer
  • 4. Rather than the mutation event described in question 3, assume that a mutation occurs in the gene at
    9·1 answer
  • Which of these statements is true of deductive reasoning?A) it moves from specific to generalB) it moves from pure to applied th
    14·1 answer
  • Why are concentration gradients important to cells
    9·1 answer
  • CAN ANYONE HELP ME WITH THE QUESTION ABOVE
    12·1 answer
  • The theory of plate tectonics states that Earth's plates are always in motion. What geological evidence supports this statement?
    14·1 answer
  • Which of the following is an example of a compound?
    13·2 answers
  • 2. Identify one simple machine used at your home and explain how it makes your work easier​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!