The cytoplasm that is in prokaryotic cells, is a gel like but also fluid substance, which all all the cellular components are suspended. the eukaryotic cells are very similar to this, but eukaritoic cells dont contain organelles.
Answer:
The head got bigger and the face got smaller. Hope his helps.
B. Cell wall and a central vacuole
The cell wall is a rigid structure that surrounds the cells and allows plants to stay upright. Animal cells are more fluid.
The central vacuole is a large region in the cell that stores nutrients and fluids. Many cells, including animal cells, contain vacuoles, but most are small, and only plant cells contain large central vacuoles.
Hope this helps!!
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
