1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
14

Which nervous system dilates the pupils and allows more light to enter the eyes?

Biology
1 answer:
Vladimir79 [104]3 years ago
3 0
The correct answer is sympathetic nervous system.
<span>
The sympathetic nervous system is a component of the autonomic nervous system, together with the parasympathetic system. Their functions are opposite but coordinate to maintain homeostasis. The sympathetic system has a role to control the body's response during perceived threat (fight and flight reactions). According to this, it dilates the pupils, contracts the muscles, increases heart rate...</span>
You might be interested in
Animals eat plants and produce carbon dioxide and water. How do animals affect the amount of carbon in Earth's atmosphere?
mrs_skeptik [129]
They do the same thing that all living and breathing things do! They breathe! When they breathe they are doing the same thing you are doing all day everyday. Inhaling oxygen and exhaling carbon dioxide.
3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
How many kinds of organisms have prokaryotic cells? how many have eukaryotic cells?
Eva8 [605]
Poowjdnxnxnsh xshbqb d x

6 0
3 years ago
WILL GIVE BRAINLIEST!!!!
Archy [21]

The main difference between Exponential growth and Logistic growth is that logistic growth takes into account carrying capacity. On a graph, logistic growth levels off as it nears carrying capacity while exponential growth does not.

Exponential growth involves a positive feedback loop and Logistic growth involves a negative one.

please mark as brainliest if correct!

3 0
3 years ago
Read 2 more answers
_____ cells are commonly dispersed (mixed in) with simple columnar epithelial cells. They are responsible for secreting mucus.
WINSTONCH [101]

Answer:

"Macrophages" cells are commonly dispersed (mixed in) with simple columnar epithelial cells. They are responsible for secreting mucus.

Explanation:

8 0
3 years ago
Other questions:
  • During the rainy season, and just as the dry season starts, food is abundant for all finches. However, as the dry season wears o
    5·1 answer
  • Positive feedback is most like _____.&lt;br /&gt;
    5·1 answer
  • A Rift Valley is associated with ?
    13·1 answer
  • What is the hardy weinberg symbol for the dominant allele
    6·1 answer
  • Plant and animal cells differ in a variety of ways. Plants have a special structure that helps them produce their own food. With
    9·2 answers
  • If your grandparents are the parental generation, what term would refer to your parents?
    8·2 answers
  • Which type of society has an economy primarily based on manufacturing
    5·1 answer
  • ¿Cuáles son los derechos que defiende el Fondo De Las Naciones Unidas Para La Infancia?
    8·1 answer
  • Mention the non-living and living characteristics of viruses?
    12·2 answers
  • Please answer this question
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!