1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
15

Homology and homoplasy produce similar traits. What is the key difference?

Biology
1 answer:
chubhunter [2.5K]3 years ago
7 0

Answer:

Homology refers to the similarities between the group of species that share the common ancestor.  The homology individuals arise from a common ancestor. They shows divergent evolution. The basic structure in homology is similar. The organs perform different function. They occur due to the evolutionary process.

Homoplasy refers to the shared characters of the group of species that do not share the common ancestor. The homoplasy do not involve the common ancestor. They shows convergent evolution. The basic structure in homoplasy is different. The organs perform the similar function. They occur due to the adaptation in different habitats.

You might be interested in
The graph below shows population data for two species.
pshichka [43]

Answer:

never give up its an order if you do then so dose life

Explanation:

never give up

3 0
2 years ago
If a goal post was separated into the four pieces that make up the base,the crossbar, and the arms, and all four pieces were lai
erma4kov [3.2K]

Answer:

68 1/2 foot length

Or 22 5/6 yards.

Explanation:

The yard length of the part of the goal post

The base (10 foot)

The crossbar (18 1/2 )

And two arms (20 foot each)

Let's sum up the total yards

=(10 + 18 1/2 + 20 +20) foot

= 68 1/2 foot length

Or 22 5/6 yards.

5 0
3 years ago
how lysosomes may be involved in the removal of the interdigital membrane of the developing mammalian fetus
Mars2501 [29]

Answer:

Lysosomes have the function of digesting substances, this function allows it to be involved in the removal of the interdigital membrane of the developing mammal fetus.

Explanation:

Lysosomes are organelles formed by numerous digestive enzymes. These enzymes allow lysosomes to be able to digest substances and even cellular apparatus, when needed.

The digestive function of lysosomes can be observed in the removal of the interdigital membrane of the developing mammalian fetus, by the action of digestive enzymes that have the ability to remove this entire membrane and any other undesirable tissue for the next stages of development of the fetus.

7 0
3 years ago
CAN SOMEONE PLEASE HELP ME WITH THIS DIAGRAM
creativ13 [48]

Answer: a mutagens d carcinogens b point mutation c frameshift e missense f nonsense

Explanation: Hope that helps!

3 0
2 years ago
Question 5
kati45 [8]

The correct answer is False!

6 0
3 years ago
Read 2 more answers
Other questions:
  • How does human activity affect earths freash water resources
    14·1 answer
  • TAKE A LOOK<br> 1. Identify What are two<br> things that are the same in<br> all nucleotides?
    14·1 answer
  • The boxer crab, Lybia tesselata, carries a small pair of anemones in its claws. When approached by a predator, it waves the anem
    13·1 answer
  • Give a basic definition of evolution as taught in this Unit 2. Answer should be at least 3 sentences long and include at least 4
    14·2 answers
  • For which of the following purposes would a transmission electron microscope be the best type of microscope to use?
    5·1 answer
  • at which stage in kohlbergs level of conventional morality does an individual realize the importance of maintaining law and orde
    9·1 answer
  • An organism living in the ocean that must have light from the Sun as an energy source would MOST LIKELY live in which of these o
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Select the correct answer.
    12·1 answer
  • The allele for a recessive trait is usually represented by a capital letter<br><br> True or false
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!