1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Deffense [45]
3 years ago
9

Why did china develop apart from other cultures

Biology
1 answer:
Zinaida [17]3 years ago
4 0
Because it was isolated from areas since the land is protected by an ocean, deserts, and dry mountains.
You might be interested in
Single-called organisms dispel of waste via
rodikova [14]
Lysosomes, which is the organelle that cleans the cell
6 0
3 years ago
What is one byproduct of slash-and-burn clearing of the rain forest that is harming the atmosphere?
morpeh [17]

It has been estimated that ‘slash and burn’ agriculture is used by up to 500 million people worldwide. The term describes the practice of cutting and/or burning of natural vegetation for conversion into agricultural fields. Besides the disastrous implications for forest ecosystems, the practice can impact the atmosphere in two main ways if burning is implemented. Firstly by causing air pollution from the smoke, and secondly by increasing carbon dioxide in the atmosphere, which is a greenhouse gas and a driver of climate change. Living trees also remove carbon dioxide from the atmosphere during photosynthesis, and the process of ‘slash and burn’ effectively removes their carbon capturing contributions to ameliorating climate change.

7 0
3 years ago
Read 2 more answers
Why did Holmes say to Watson, “My dear doctor, this is a time for observation, not talk.”?
anzhelika [568]
Holmes said to Watson "My dear doctor, this is a time for observation, not talk, because it was part of his method to observe closely and then to consider his observations. The correct answer is A. 
8 0
3 years ago
In humans, skin color is controlled by several genes. thus, skin color is a(n) ____ characteristic.
andrezito [222]
Genetic or Inherited
4 0
3 years ago
If the heart becomes damaged or weakened, how will this affect the body’s systems?
jek_recluse [69]
Think of blood as a gas/ fuel for the car ( your body). If there is no fuel, there's no movement (dead) so when the fuel tank is damaged the car won't function properly. 
 So if the heart becomes damaged, or weakened it would start making blood clots and damage the organs that need blood to function properly. The circulatory system wouldn't function properly and because other organs depend on the circulatory system it would cause a chain reaction, affecting other body systems. <span />
3 0
3 years ago
Read 2 more answers
Other questions:
  • Cell specialization in the human body is usually due to
    9·1 answer
  • What is the largest organelle in plants
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Simplify the following expression. (2x - 5)(6x2 - 6x - 11) A. 12x3 + 18x2 - 52x - 55 B. 12x3 - 42x2 + 8x + 55 C. 12x3 - 18x2 - 5
    14·1 answer
  • Please help, 53 points brainliest 5 stars thanks!
    8·2 answers
  • what is one possible combination that can be found in the gamete formed by an individual with the genotype AaBB?
    9·1 answer
  • DNA replication requires all of the following EXCEPT: a template, that is, a strand or strands to be copied. the monomers that a
    12·1 answer
  • during which phase of the cell cycle is the cell actively participating in the functions of a multicellular organism as well as
    8·1 answer
  • Prehistoric hunters killed and ate mammoth.Mammoths ate grass.Draw a food chain to show how prehistoric hunters got energy from
    8·1 answer
  • How is a plant cell built?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!