Igneous rocks are formed when the magma from an erupting volcano eventually cools this rock is extrusive- found on the earth's surface.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The answer is A) Homologous structures
Explanation:
Homologous Structures:
- Homologous structures are anatomical features in an organism that are structurally and functionally diverse but they originate from a single common ancestor.
- Homologous structures possess a similar basic internal structure but can have entirely different morphology and function.
- For example, the wings of a bat and a human's arm have the same internal structure but they have different functions.
- Vestigial structures are evolutionary remnants that no longer serve a purpose in modern forms or descendants of the original organism.
- Inherited and developmental are out of context in terms of evolutionary relationships.
