1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zolol [24]
2 years ago
6

What is the opposite of evaporation? How do these processes differ?

Biology
2 answers:
astraxan [27]2 years ago
7 0
Precipitation, evaporation is when all the water is being absorbed into the clouds and precipitation is when the water is being released from the clouds.<span />
vovangra [49]2 years ago
5 0
Condensation because condensation is gas to liquid
You might be interested in
There are more of fewer kinds of plants than animals.
MakcuM [25]
1,203,375 different species of animals on earth and 1,589,361 different species of plants on earth (so your answer is more)
4 0
3 years ago
What is waters role In forming fossil
Elodia [21]

Answer:

After an organism's soft tissues decay in sediment, the hard parts — particularly the bones — are left behind. Water seeps into the remains, and minerals dissolved in the water seep into the spaces within the remains, where they form crystals. ... If that mold gets filled with other minerals, it becomes a cast.

Explanation:

6 0
3 years ago
Read 2 more answers
What color is produced upon the addition of methyl red indicator to a culture of a Gram negative bacilli in MR-VP broth if the o
Leni [432]

Bright cherry red color is produced upon the addition of methyl red indicator to a culture of a Gram negative bacilli in MR-VP broth if the organism used the mixed acid pathway of fermentation.

What is MR-VP test?

  • As part of the IMViC testing, Methyl Red (MR) and Voges-Proskauer (VP) broth is utilized as the medium in which both the Methyl Red and Voges-Prosakuer tests can be conducted.
  • It is a straightforward broth made up of dextrose or glucose, buffers, and peptone.
  • In the Methyl Red test, an infected tube of MR-VP broth is mixed with the pH indicator methyl red.
  • The acids will overwhelm the buffers in the medium and create an acidic environment if the organism employs the mixed acid fermentation pathway and creates stable acidic end products.
  • If acidic end products are present when methyl red is introduced, the methyl red will remain red.

Learn more about the MR-VP test with the help of the given link:

brainly.com/question/27962086

#SPJ4

5 0
1 year ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Summarize how biochemical characters can be used to determine phylogeny
svp [43]

Phylogeny uses communal ancestry to group organisms and further nest them into bigger and bigger groups. This is also a study of evolutionary relationships among organisms. Visible characteristics such as anatomical and behavioral traits, as well as biochemical (enzymes, proteins, pigments, etc.) and genetic traits (nucleotide sequences) that need more modern techniques to detect.  

6 0
3 years ago
Read 2 more answers
Other questions:
  • Among a species of butterflies, the color blue (B) is a dominant trait. Yellow color (b) is a recessive trait. If a pure blue bu
    12·2 answers
  • I REALLY NEED HELP. I DO NOT GET THIS AT ALL. PLEASE HELP ME. IT WILL BE GREATLY APPRECIATED.
    9·1 answer
  • What is one type of white blood cell that participates in the specific immune response called? A. antigens B. antibodies C. macr
    12·2 answers
  • Which scenario describes a way that an abiotic factor can impact a marine system? Liquid water turning into solid ice encourages
    11·1 answer
  • Nucleric acids in eukaryotes, DNA is found chiose all apply
    5·2 answers
  • Which process does not release energy from glucose?
    7·2 answers
  • Which is most likely to get hot fastest when touching a warm surface?
    13·2 answers
  • Which sequence of events BEST describes secondary succession?
    10·1 answer
  • What is the main goal of the Pacific Region Coastal Program?
    7·2 answers
  • PLEASE HELP⚠️⚠️⚠️⚠️
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!