B) Bb x Bb because to have blue eyes they need to get the trait from both parents
Sexual reproduction<span> provides </span>genetic diversity<span> because the sperm and egg that are produced contain different combinations of </span>genes than<span> the parent organisms. ... Each resulting cell, or gamete, resulting from meiosis has only half the amount of DNA as the parent cell.</span>
Answer:
Active transport: movement against a gradient To move substances against a concentration or electrochemical gradient, a cell must use energy. Active transport mechanisms do just this, expending energy (often in the form of ATP) to maintain the proper concentrations of ions and molecules in living cells.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
