1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
3 years ago
11

viruses and bacteria are both microscopic and can both cause disease. viruses differ from bacteria in that all viruses a. cause

insect transmitted diseases. b. can be destroyed by antibiotics. c. have cell walls. d. need a living host cell to reproduce.
Biology
1 answer:
stepan [7]3 years ago
3 0
I believe the correct response is D. Need a living host cell to reproduce.
You might be interested in
What is this diagram representing?
mestny [16]
Photosynthesis is the process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a byproduct.
7 0
2 years ago
True or false ? Grasslands are quick to develop into a climax community <br> True<br> False
maksim [4K]

Answer:

True

Explanation:

Tbh i dont remember sorry :(

7 0
3 years ago
Cats and other nocturnal predators have a greater number of rod cells in their eyes compared to cone cells. What would you predi
Annette [7]

It is possible to predict that because of the decreased number of cone cells, cats have poor color vision.

<h3>What are cone cells?</h3>

Cone cells are specialized cells in the eye required to produce the spectra of color observed in nature.

Cone cells can be considered photoreceptors located in the retina of the eye (in animals and humans).

Cone cells act in the best way in bright light conditions, conversely to rod cells that serve to observe at the night.

Learn more about cone cells here:

brainly.com/question/13942524

8 0
2 years ago
Which of the following is an ecological factor that would fail to exert pressure on a species of anole lizards to evolve into ne
Svetach [21]

Answer: the correct option is B (predators localized to a particular habitat

Explanation: the ecological factor that would fail to exert pressure on a species of anole lizards to evolve into new species of ecomorphs is predators localised to a particular habitat. Ecomorphs are local variety of species whose appearance is determined by its ecological environment.

Accessibility to cooling mud baths, availability of and competition for food, appropriate areas for shelter and nesting has to do with its surroundings and environment and thus affects is evolution. Hope this helps. Thanks.

3 0
2 years ago
Under what conditions would a climate be classified as arid
Norma-Jean [14]
<span>In order for a climate to be considered "arid", a region/land must have scare rain that does not support the growth of vegetation. It is thought to be an areas that has minimal water sources that cannot produce greenery or other foliage. Arid can be considered extremely dry which will impact the surrounding land's ability to support growing life including plants and other animals.</span>
6 0
3 years ago
Other questions:
  • At the 1992 Earth Summit, representatives from around the world
    7·1 answer
  • How does thermal energy differ temperature
    6·1 answer
  • Which cell is the most specialized?
    12·2 answers
  • What are the three parts of a cell theory?
    6·1 answer
  • Which of the following statements is true of fetal alcohol syndrome?
    11·1 answer
  • What would be the strand of complementary DNA produced by the strand of DNA shown below? ATG CGA
    8·2 answers
  • What is the technique of filling the viewfinder? How does this help to focus on your subject?
    10·1 answer
  • An unknown organism is brought to a scientist. She must decide if it is a fungus or a protist. Which claim about the organism is
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Muscle and nerve cells have developed which characteristic more than other cells?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!