Which factors are most significant in describing the climate of a region

1 answer:

8 0

Climate describes the average conditions and atmospheric patterns of a region over time. In describing the climate of a region one may specifically include precipitation, humidity, temperature, sunshine, wind velocity, fog, frost, and hail storms that have been observed for a long period of time.

The average weather statistics for determining a region's climate is in a span of 30 years. Scientists must make observations within a specified interval to determine the climate of a particular location.

You might be interested in

Imagine that you are the scientist who discovered cells. If you were to give a speech to a group of fellow scientists, what key

jolli1 [7]

The key points about cell theory are as follows:
1. All living organisms are made up of cells; the organisms may be unicellular or multi cellular.
2. The cell is the basic unit of life.
3. New cells are derived from pre-existing cells.
4. All cells maintain homeostasis.
Some new facts have been added to these basic facts; the new facts added include the following:
(A). Energy flow occur withing all living cells.
(B). Hereditary information derived from DNA is passed from cell to cell.
(C). All living cells are made up of the same basic chemical compositions.

5 0

3 years ago

Read 2 more answers

Which of the following substances is a weak base? .... lemon juice , vinegar , sea water , or pure water

larisa [96]

Pure water is your answer

8 0

3 years ago

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?