1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
3 years ago
12

Using Figure 1 answer the following questions: What is the probability (enter a percentage) of producing an offspring with the f

ollowing Genotypes
PP?
pp?
Pp?

you have to put the percentages for PP pp Pp
Biology
1 answer:
FinnZ [79.3K]3 years ago
7 0

Answer:

PP = 25%

Pp = 50%

pp = 25%

Explanation:

Using punnett square, we can predict the percentage probability of genotypes.

          P      p

P      PP     Pp

p     Pp     pp

In this cross we have,

PP  = 1/4 = 25%

Pp  = 2/4 = 50%

pp  = 1/4  = 25%

We have ratio,

1 : 2 : 1

You might be interested in
Body Type: DNA code- AGTGCCTTC RNA code- ___________ Amino Acid sequence (aka protein)- ___________________ Body Type?- ________
olga2289 [7]

Answer:

The correct answer would be:

  • mRNA sequence - UCACGGAAG,
  • amino acid sequence - Ser-Arg-Lys, and
  • body type - dwarf

By central dogma, we know that nucleotide sequence of deoxyribonuceic acid (DNA) form the amino acid sequence of a polypeptide chain.

Nucleotide sequence of DNA is first decoded in the form of nucleotide sequence of mRNA (messenger ribonucleic acid) under the process of transcription. The sequence of RNA is complementary to the nucleotide sequence of template strand of DNA. In addition, uracil is present in RNA in place of thymine.

tRNA (transfer RNA) then deciphers the codon sequence of mRNA into amino acid sequence of polypeptide sequence by the process of translation.

Now, given DNA sequence is AGTGCCTTC.

so, the mRNA sequence would be UCACGGAAG.

Codon sequence is UCA CGG AAG.

So, the amino acid sequence would be Ser-Arg-Lys.

Hence, the trait of showman performer would be dwarfism.

Codon sequence chart is attached for reference.

5 0
3 years ago
A grassland is experiencing a severe drought. The lack of rain is causing the grass to die and the ponds and creeks to dry up.
dusya [7]

The population of fish will decrease.

The population of grazing animals will decrease.

<h3>What is drought?</h3>

A drought is a prolonged period without enough precipitation/water to support people, animals or crops.

With less water, fish and other creatures have fewer places to dwell, swim, and evade predators. In the near run, shrinking streams and lakes necessarily result in fewer fish. Drought conditions can cause water temperatures to rise, affecting cold-water species such as native trout.

The population of grazing animals would decrease as the grass is a food source and without their food source, there would be no source of staying meaning that they would result to finding new food sources through migration likely.

7 0
2 years ago
In what region of the United States did most of the battles shown on the map occur?
Alexeev081 [22]

Answer:you

Explanation:ypu

7 0
3 years ago
Warmer summertime temperatures in the northern hemisphere are due partly to
Sveta_85 [38]
<span>Warmer summertime temperatures in the northern hemisphere are due partly to the tilt of the earth's axis around the sun when it is at its lowest point. The northern hemisphere has usually shorter hours in the day and longer hours in the night that is why it always happen during the winter. Because the sun is a bit far away from these islands, people living in this area will expect colder atmosphere.
</span>
5 0
3 years ago
When organisms die, how does carbon re-enter the environment?
riadik2000 [5.3K]

Explanation:

carbon dioxide released during decay.

3 0
3 years ago
Other questions:
  • Amenorrhea may occur among women at fat levels as high as:
    12·1 answer
  • Which successional stage lasts longest? (Ecological succession)
    8·2 answers
  • All of the following are traits of echinoderms except
    10·2 answers
  • Which of the following is NOT a layer of the alimentary wall
    6·1 answer
  • 1. What causes the autorhythmicity or action potentials of the nodal cells? a. A decrease in chloride permeability b. A gradual
    10·1 answer
  • What is the structures of carbohydrates?
    11·1 answer
  • Hemophilia is a serious bleeding disorder cause by a sex-linked recessive allele. What are the chances of a normal male and a fe
    14·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Everything including you and me is made up of matter<br> True or False
    9·2 answers
  • Using the ICD-10-CM code book, assign code(s) for the following
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!