1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ZanzabumX [31]
4 years ago
13

What cover the nucleus of a cell

Biology
2 answers:
bija089 [108]4 years ago
8 0

Answer:

The nuclear membrane or nuclear envelope which is a double lipid bilayer

professor190 [17]4 years ago
8 0

Answer:

Nuclear Envelope

Explanation:

The nucleus is covered by the nuclear envelope, which is a double membrane that protects DNA both physically and chemically.

You might be interested in
A peron with cystic fibrosis releases few enzymes into their small intestine. Explain what problems this cause?
kow [346]
This would make it hard for a person to digest their food because enzymes are used to help speed up the process of its specific job
6 0
3 years ago
A blood vessel that carries blood filled with waste products from the body cells back to the heart.
MrMuchimi

Answer:

C- The Veins carry blood from the body cells to the heart.

6 0
3 years ago
Which statement best describes a difference between a molecule of DNA and a molecule of RNA?
Naddika [18.5K]

Answer: B

Explanation:

6 0
3 years ago
5 things you eat that contains corn,soy,rice,or potato's
nignag [31]

Answer:

1. Tortilla Chips

2. Tacos

3. French fries

4. Soy sauce

5. Tofu

Explanation:

Trust Milky. Milky smart.

3 0
3 years ago
Read 2 more answers
Sprinklers are the newest form of sprinkler systems and rely on ultra-fine mists instead of traditional shower-type systems. pre
Anastasy [175]
<span>Choice (B) is the correct answer. Water-mist sprinklers are the newest technology in sprinkler systems. These allow for less water to be used overall while still attaining the same level of fire extinguishing. Instead of using a shower that soaks everything underneath, a fine mist will still put the fire out while possibly saving some areas of the building from damage.</span>
6 0
4 years ago
Other questions:
  • What is it called when you have a small particles of RNA and protein???
    15·1 answer
  • The density for potassium is 0.856 g/cm3. What would be the mass of a 40 cm3 piece of potassium?
    5·1 answer
  • Aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    7·1 answer
  • What are two jobs of the skin
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following binds to the active site of an enzyme?
    7·1 answer
  • Wildlife can be scarce in many large, densely populated cities. A few plants and animals can be found in these areas. For exampl
    8·2 answers
  • 1. Explain how forces of attraction and repulsion exist within an atom.
    10·1 answer
  • You went running on a hot day. After your run, you sit down and feel very warm. How is homeostasis reacting?
    12·1 answer
  • Will give brainliest for the first answer!!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!