1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
4 years ago
6

1. What are some of the challenges that those working in wildlife rehabilitation face in treating animals?

Biology
2 answers:
nignag [31]4 years ago
7 0
Some challenges of those who work in wildlife are having to get use to the outdoor and mosquito bites, getting the animals use to them so they do not bite, and Getting used to heat
zysi [14]4 years ago
4 0

One of the greatest difficulties in wildlife rehabilitation is not being able to support every animal. Sometimes, despite doctors' and rehabbers' real efforts, animals are not able to be discharged. In order to survive in the wildlife and be releasable, animals require to be 100% healthy. If a bird could not fly, or a mammal could not see, wildlife rehabilitators could not free them back to the wild because they will not sustain.

Wild mammals don't have masters that pay the bills for their treatment. Most wildlife rehabilitators and dispensaries depend on charity from human sponsors to fund for the food, medications, and other supplies they require to care for wild animals. Finding the money required to treat and rehabilitate wildlife can be very challenging.

Injured or ill creatures in custody can be a menace to those attempting to help them. Birds of prey like falcons and owls have powerful feet with sharp hooks that can harm people. Many creatures like raccoons and even squirrels can nibble very hard.

You might be interested in
What nutrient should provide the largest percentage of calories in the balance diet 1. carbohydrates 2. incomplete proteins 3.sa
elixir [45]
Carbohydrates should be the largest!
4 0
3 years ago
What is the irradiance of the sun dependent on?
Valentin [98]
The answer is A
The wavelength of the radiation energy it emits
6 0
3 years ago
While examining a specimen under the microscope, Janet discovers a structure that has some genetic material that has RNA but not
gregori [183]
The specimen is most likely some type of virus.
6 0
3 years ago
Read 2 more answers
How many<br> dependent<br> variables do you<br> want in an<br> experiment?
IrinaK [193]

Answer:

you only want 1

Explanation:

hope this helps

7 0
3 years ago
Read 2 more answers
The allele for blue feathers is dominant. The allele for brown feather is recessive. If one bird that is homozygous dominant is
balu736 [363]

Answer:

The following punnet square would be constructed from the above mentioned cross:

        b             b

B     Bb           Bb

B     Bb           Bb

A punnet square can be described as a diagram which is made to illustrate the outcomes of a cross.

The results from the above punnet square show that the offsprings produced from a cross between homozygous blue and brown parent, will all have blue feathers but they all will be heterozygous for the trait.

6 0
3 years ago
Other questions:
  • 1. What method did Theodor Schwann use to verify his hypothesis that all living things are
    11·1 answer
  • What did Wallace conclude from observing that the bones in manatee flippers look similar to the bones in a human arm and hand? W
    14·1 answer
  • Which planetary body was spirit designed to explore
    9·1 answer
  • In pea plants, a single gene controls pea texture. Smooth (S) peas are dominant over wrinkled (s) peas. A plant with smooth peas
    5·1 answer
  • What is the name for a molecule that is made of two sugar monomers bonded together?
    6·2 answers
  • The following answers for the Causes and Consequences features are examples and are not intended to represent a comprehensive li
    6·1 answer
  • Question reply thank you
    8·1 answer
  • Which among these is a biotic factor?
    15·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Of the three pathways for obtaining atp for muscle contraction, which one requires oxygen?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!